1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Aleonysh [2.5K]
3 years ago
15

45. The main product(s) of the light-independent ( dark reactions ) of photosynthesis is/are

Biology
1 answer:
alexira [117]3 years ago
8 0

Answer:

C. glucose

Explanation:

Dark reaction takes place outside the thalakoid membrane (stroma and cytoplasm). During dark reactions, energy is released from ATP and NADPH to fix carbon dioxide into <em><u>glucose</u></em>.

Option A and B are not correct because they are produced during light reactions. Likewise, chlorophyll is the part of cell and is not prepared during light or dark reactions at all.

You might be interested in
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
BRAINLIESTTT ASAP!!!!
Igoryamba

When animals undergo the process of cellular respiration, they release carbon dioxide into the atmosphere. And when animals die and start to decay aided by organisms called decomposers, carbon dioxide is also emitted into the atmosphere. When humans burn fossil fuels, carbon dioxide yet again enters the atmosphere. 

<em>hope this helps ;)</em>

5 0
3 years ago
Read 2 more answers
Which area has a drier climate northern Australia or north Australia
andreyandreev [35.5K]

Answer: north Austria have very dry summers and the winters are cooler and drier

Explanation:

8 0
3 years ago
A fertilized zygote created through meiosis and sexual reproduction -
Yuliya22 [10]

Answer:

A fertilized zygote created through meiosis and sexual reproduction has a combination of genetic material

8 0
3 years ago
Read 2 more answers
What is the process that allows people to improve the chances that offspring will have a desired trait
jekas [21]

Answer: Selective breeding

Explanation:

Selective breeding or artificial breeding is a process that allows humans to select parents in plants and animals that have desirable traits. Such parents are bred to produce offspring that have desirable traits from both parents. Humans have bred many species of plants and animals to improve the quality of plant and animal yields in terms of crops, milk, meat, eggs, and other derivatives.

5 0
2 years ago
Other questions:
  • What's the meaning of bio​
    8·1 answer
  • What role do surface properties play in determining the lifespan of a flu virus?
    13·1 answer
  • What characteristic is required to be classified as a protozoan?
    13·1 answer
  • The name of which leader best completes the title of the graphic
    7·1 answer
  • Describe how eukaryotic plant cells store and remove waste.
    12·1 answer
  • Two steel balls that are the same mass and size are rolled with the same force across different level surfaces.
    15·2 answers
  • Streptococcus pyogenes is classified with _____. Streptococcus pyogenes is classified with _____. proteobacteria chlamydias spir
    12·1 answer
  • Boards of pharmacy regulate pharmacists
    7·2 answers
  • Which statement is true about the scientific method? It follows one prescribed sequence of steps. It begins and ends with an exp
    13·1 answer
  • :-) :-) :-) :-) :-) :-) :-) :-) :-)<br>Please help
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!