1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
hoa [83]
3 years ago
6

How do you translate this? *The last picture was upside down*

Biology
1 answer:
Nataliya [291]3 years ago
3 0

Compliment: ATCCGCTGCAGCATATGGCCAATG

mRNA: AUC CGC UGC AGC AUA UGG CCA AUG

The best I can do, good luck.

You might be interested in
Selective Breeding can have both pros and cons. For example, you can achieve a ‘desirable’ look of the breed that you want. Howe
loris [4]

Answer:

poop

Explanation:

poop

5 0
3 years ago
While biodiversity includes the number of species in a given area, it also includes:_________
grandymaker [24]

While biodiversity includes the number of species in a given area, it also includes phylogenetic lineages.

<h3>What is biodiversity, exactly?</h3>

The variety of animals, plants, fungi, and even microorganisms like bacteria that make up our natural environment are all included in what is known as biodiversity. These various species and critters collaborate in complicated web-like ecosystems to keep things in balance and support life.

<h3>What kind of biodiversity is that?</h3>

As a group of distinctive living entities having the capacity to reproduce with one another, biodiversity. Blue whales, white-tailed deer, white pine trees, sunflowers, and minuscule germs that are even too small to be seen with the eye are a few examples of species.

<h3>How can biodiversity be preserved?</h3>

Purchasing fewer products and ensuring that the ones you do purchase have a minimal impact on biodiversity investing in initiatives to advance biodiversity.

learn more about biodiversity here

<u>brainly.com/question/26110061</u>

#SPJ4

8 0
2 years ago
A term used to describe organisms that cause disease​
sdas [7]
The answer is a pathogen

If this answered help you then please consider marking it as brainliest to help me level up to expert
4 0
3 years ago
Read 2 more answers
A substance that dissolves in water and increases the concentration of h by adding more h to the water is called a(n)
sertanlavr [38]
<span> Animal cells will swell when they are placed in a hypotonic solution</span>
4 0
4 years ago
How do cells change as you grow?
FinnZ [79.3K]
They become more large and are less able to divide and multiply.Which as an increase in pigment and a fatty substance inside the cell . (Hopes this helped)
5 0
3 years ago
Other questions:
  • All individuals have two alleles for a given trait. According to Mendel's ____________, these alleles are passed down one each f
    10·2 answers
  • George has been collecting data for his science fair project which focuses on how different amount of fertilizer affects the gro
    8·1 answer
  • Which strategy do geologists use to locate the center of an earthquake? A. They only analyze local data. B. They collect data fr
    15·2 answers
  • The biotechnology developed for the forensic dna profiling process includes contributions from the sciences of _____.
    9·2 answers
  • Assume that a dihybrid cross is made in which the genes' loci are autosomal, independently assorting, and incompletely dominant.
    7·1 answer
  • What is respiration​
    13·2 answers
  • Present and debate current social and ethical implications of biotechnology and genetic engineering
    10·1 answer
  • What does it mean when we say water utilities "treat" water?​
    6·2 answers
  • Why do farmers use artificial selection
    6·1 answer
  • Explain how seasonal fires benefit grassland ecosystems
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!