1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
k0ka [10]
3 years ago
10

Compare and contrast the photic and midnight zone.

Biology
1 answer:
Dennis_Churaev [7]3 years ago
4 0

Answer:

In an oceanic environment the photic zone is the zone where light can be received it's usually from 0 to 200 m deep but this depth can be modified by the turbidity of the water. The aphotic zone is the zone where no light is receives it goes from 200 to the bottom of the sea.

Explanation:

You might be interested in
Please help me with this
Aleksandr [31]

Answer:

bro ineed help to

Explanation:

4 0
3 years ago
Read 2 more answers
How will a punctured lung affect your ability to inspire?
Allisa [31]
1) Pneumothorax in this case; a spontaneous pneumothorax can be life threatening cause the lung will eventually cause vacuum used by the lung to fill with air, and as you constantly expand your lung it decreases and collapses. So C is going to be the answer.

2) Acetylcholine is the hormone responsible for the "Rest and digest". It is the direct opposite of the Fight and Flight reaction which is marked in Bronchodilation, Increased HR, and increased BP. B

3) Secretin is responsible for stimulating the release of bile by the liver. Secretin is released by the duodenum, the junction of the stomach and small intestines. B
7 0
3 years ago
Two advantages of secondary tissues?
harkovskaia [24]

Explanation:

Whereas primary tissues allow for vertical growth, secondary tissues allow for lateral growth: they allow stems and roots to become wider. In roots, the formation of both secondary meristems involves the pericycle.

4 0
3 years ago
Which chemical is not found in DNA nucleotides?
trapecia [35]

the answer is ribose and I go it from Gradpoint

8 0
3 years ago
Read 2 more answers
What is true concerning hemoglobin.
Fynjy0 [20]

Answer:

A protein molecule present in the RBCs, which helps in the transportation of oxygen from the lungs to the different parts of the body and brings back carbon dioxide, that is, collected from different parts of the body back to the lungs is known as hemoglobin.  

The general features of hemoglobin are that it comprises four molecules of protein in the form of globulin chains. In adults, the molecules of hemoglobin comprise two beta-globulin chains and two alpha globulin chains, while in infants and fetuses, the beta chains are least found, and is substituted by two gamma chains.  

Each globulin chain comprises an essential iron-containing compound porphyrin, which is termed as heme. Together both iron and heme play an essential role in circulating oxygen and carbon dioxide in the blood. This iron gives the red appearance to the blood.  

6 0
4 years ago
Other questions:
  • Can the work output of an engine be greater than the source of energy? A. yes, sometimes B. yes, always C. no, sometimes D. no,
    11·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Symptoms of menopause maybe treated with
    12·2 answers
  • You have been hired to forecast future population level for a small country. You know that this country currently has 25 million
    9·1 answer
  • What could happen to target cells in an animal that lack receptors for local regulators?
    15·2 answers
  • What is animal nervous system​
    11·1 answer
  • The recirculation of fluids in the body is essential to homeostasis, eliminating local variations in the fluids, maintaining blo
    13·1 answer
  • What is DNA and what is it function
    7·2 answers
  • ¿Qué suministran los procesos catabólicos a la célula?¿Qué suministran los procesos
    7·1 answer
  • Sean lives in an area that experiences hot, dry summers that change gradually to cold, snowy winters. If he wants to forecast th
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!