1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Harrizon [31]
3 years ago
12

Which of the following best describes a player's role in any game?

Mathematics
1 answer:
trapecia [35]3 years ago
8 0
Thank you for posting your question here at brainly. I hope the answer will help you. Feel free to ask more questions.
Below are the choices and the answer is C. 

A. T<span>he way he or she scores points.
</span>B. <span>The number of turns he or she gets to take
</span>C. <span>The actions expected of him or her.
</span>D, <span>The name of his or her character.</span>

You might be interested in
A washer and dryer cost a total of $960. The cost of the washer is three times the cost of the dryer. Find the cost of each item
xeze [42]

Cost of washer: $720

Cost of dryer: $240

I've taken this test before and got it right, so you're good :)

8 0
3 years ago
What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
Papessa [141]

Answer:

AATTGGCCATGCATGATTACGA

TTAACCGGTACGTACTAATGCT

Step-by-step explanation:

A's and T's, C's and G's. Just switch the letters for their partner.

8 0
3 years ago
Read 2 more answers
What is the quotient if<br> 1/3 of 10 is divided by 1/7 of 8/12? Reduce if possible.
GalinKa [24]

Answer:

2.75

Step-by-step explanation:

7 0
3 years ago
Gary can hike 2.5 miles in 30 minutes.At that rate, how long will it take him tohike the 8 miles to Chena Lake?
4vir4ik [10]

Answer:

96 minutes

Step-by-step explanation:

1. find the quotient of 8 and 2.5. Which is 3.2

2. then find the product of 30 and 3.2 to get 96 minutes.

8 0
3 years ago
Use distributive property to multiply: 2 1/2 x 3 1/4
FromTheMoon [43]
2 1/2= 5/2
3 1/4= 13/4
5/2•13/4= 65/8 or 8/18
Hope this helped!
7 0
3 years ago
Other questions:
  • What is the scale factor of figure ABCD?
    10·1 answer
  • Geometry please help if you can​
    6·1 answer
  • If I paid 3.00 for 2 chocolate bars how much would i pay for 6,700?
    13·1 answer
  • Hey, I need help! 2+2+=?
    10·2 answers
  • You scored 85% on your math quiz. The quiz was out of 50 points. How many points did you get?
    15·1 answer
  • Are the graphs of each pair of equations parallel, perpendicular,or neither? PLEASE I NEED YOUR HELP
    5·1 answer
  • Simplify the following expression
    13·1 answer
  • SOLVE FOR J. <br><br> j+11.98≥-7.02 <br> (that is not a subtraction sign its a negative sign!!)
    9·1 answer
  • 70×2 -40 = what answer right this is for fun you'll get brainliest​
    7·2 answers
  • Y^2 − 20x − 6y − 51 = 0
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!