Answer:
The answer is A, B, C and E.
Explanation:
Genetic counselors are responsible for recommending genetic testing according to the need of the patient and then guiding them through the process and helping with their decision after interpreting the genetic test results.
Out of the given options in the question, D does not apply to the given statement that if a genetic counselor recommends a genetic test or not because wanting to increase an unborn child's intelligence is unethical and is in the field of genetic engineering which is not approved.
The examples given in the options A, B, C and E are all examples of people that are seeking treatment for themselves either for curing a disease or preventing it and in those cases, the genetic counselor can recommend a genetic test.
I hope this answer helps.
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
Answer:
A. Supine is lying on the back; prone is lying with the back facing up
Have a good day!
Answer:
Ocean temperatures can cause large storms such as hurricanes or tropical storms. Warmer ocean waters create larger and stronger storms as well as keep said storms going longer. Warmer ocean waters can also cause the temperature in the immediate air around it to be slightly warmer.
Please give brainliest.
Explanation:
Answer:
Corresponding mRNA Sequence: ALGUG GAACC_GCUG CLGA
Amino Acid Sequence: METHIONINE-LEUCINE-GLUTAMIC ACID-PROLINE
