1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Blizzard [7]
3 years ago
9

Hii! i’ll give brainliest pls help

Biology
2 answers:
Nadya [2.5K]3 years ago
7 0

Answer:

This looks like an earthquake

Explanation:

There doesn’t seem to be very much water present in the image which would be the cause for the rest of them

Hope this helps

Vedmedyk [2.9K]3 years ago
4 0

Answer:

Earthquake

Explanation:

First off I wouldn't say landslide because if it was a landslide in more than likely would have cracked the concrete on the floor that the people are standing on and there would be more of a mess than what is show in the picture. Next I wouldn't say tsunami depending on how frequent this disaster was, if it was a tsunami more than likely most of that rubbish would have been soaked with water in other things that were in the water as well and I wouldn't say flood either because once again nothing is soaked with water with in that picture not even the concrete that the people are standing on so I say that the most reasonable answer would be earthquake due to them being know for destroying buildings alot.

You might be interested in
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
What causes Down syndrome?
guajiro [1.7K]
Im pretty sure that its nondisjunction
4 0
3 years ago
Read 2 more answers
How does competition shape communities?
mixas84 [53]
Competition shapes communities because it is something that people must learn to help eachother out with
3 0
2 years ago
Job on enzyme, substrate and active site
White raven [17]

These pockets contain the active site, which is the area of an enzyme where the substrate binds and the chemical reaction takes place. In the active site, amino acids of the enzyme protein will bind to the substrate. ... When binding to a substrate, enzymes may undergo an induced fit.

8 0
3 years ago
Shape is a chemical property.<br> True<br> False
stepladder [879]

Answer:True

Explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • 12 = -4(-6x – 3) wht is it <br>​
    6·2 answers
  • This system transports blood through the body and heart.
    6·2 answers
  • Are lysosomes found in eukaryotic cells, prokaryotic, both, or neither?
    8·1 answer
  • Could someone please explain what a 'Thallus' is?
    7·1 answer
  • What is the ocean feature identified in the illustration?
    5·2 answers
  • Transgenic bacteria can be used to produce
    11·1 answer
  • Pasteurization Select one: a. kills all vegetative forms. b. reduces the number of vegetative forms. c. reduces the number of en
    5·2 answers
  • How many chromosomes are in a gamete cell (egg or sperm) in a fruit fly?
    7·1 answer
  • The frequency of a lethal allele in a population is greatest when it is: Group of answer choices dominant manifested in infancy
    14·1 answer
  • EVIDENCE FOR EVOLUTION 3 OF 3 Biogeography Evidence Oceanic islands can be home to species found nowhere else on Earth. Why? Isl
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!