1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
IrinaK [193]
4 years ago
6

Which recording station is farthest from the epicenter

Biology
1 answer:
frez [133]4 years ago
6 0
It’s RECORDING STATION X.
You might be interested in
What happens when a cold front replaces a warm front
STALIN [3.7K]

Answer: It creates what's called an occluded front.

Explanation: When a cold front overtakes a warm front, it creates what's called an occluded front that forces warm air above a frontal boundary of cooler air masses.

8 0
2 years ago
In mitosis the daughter cells are identical to the parent cell. How do the cells produced during meiosis differ from those produ
wolverine [178]

Answer:

The cells produced during mitosis are identical but cells produced in meiosis are different.

Explanation:

This is because in mitosis, there is no crossing over, but crossing over occur in meiosis. During crossing over, there is swapping of the genetic material.

7 0
3 years ago
During bacterial translation, initiation occurs in three steps. Which step is last?.
Olegator [25]

Bacterial translation is initiated in three steps. In the final step, the large ribosomal subunit binds to the mRNA.

The ribosome's translation of an mRNA molecule occurs in three stages: initiation, elongation, and termination. The small ribosomal subunit binds to the beginning of the mRNA sequence during initiation. Most eukaryotic mRNAs initiate translation by binding Met-tRNAiMet to a 40S subunit, followed by ribosomal attachment at the 5′ end of an mRNA, scanning to the initiation codon, and joining with a 60S subunit to form an 80S ribosome. The stages of translation should be completed in the following order: Initiation, Elongation, and Termination.

Learn more about translation here:

brainly.com/question/12463306

#SPJ4

3 0
1 year ago
Prokaryotic cells lack what ?
Ivenika [448]

Answer:

They lack a defined nucleus

Explanation:

6 0
3 years ago
A new fossil called Darwinius was discovered in Germany. It lived around 47 mya. It had a small brain, short snout, and postorbi
vovangra [49]

Explanations:

Darwinius is also known as Ida. some scientists have grouped it to be a member of the adapiforms. it's remains were unearthed in Germany. it is regarded as a female because it's skeleton lacks baculum.

Instead of claws darwinius have nails. they could be classified as transitional fossils <u>due to its links with living strepsirrhines and also living haplorhines</u>

similarities with haplorhines:

1. they share similar body structure and tail, also their nails are similar

2. there feeding is almost the same in terms of diet they are carnivores.

similarities with strepsirrhines:

1. they are both mammals

2. they have close body structure and also almost same tail

6 0
4 years ago
Other questions:
  • Give an example of each type of Ecological Relationship:
    15·2 answers
  • In photosynthesis, the set of reactions that use NADPH and ATP formed in the light-capturing reactions to drive the fixation of
    5·1 answer
  • What do cells gain from having mitochondria and chloroplasts
    6·1 answer
  • Which organelle breaks down compounds and small particles in the cell?
    13·1 answer
  • What molecule is represented by the molecular module shown below?
    8·1 answer
  • Why is the shape of water important?
    5·2 answers
  • Which human activity has the lowest effect on global stability?
    13·1 answer
  • There are two different alleles for flower color, P and p. The image shows a white sweet pea that is labeled with its two allele
    12·2 answers
  • You are given the following DNA sequence and have determined that it is the sense parental strand. ATTGCCATGAAACGCCCCGGTACACCATT
    15·1 answer
  • The light micrograph shows dividing cells near the tip of an onion root. Identify a cell in each of the following stages: propha
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!