1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nady [450]
3 years ago
6

Each carbon molecule can bond with as many as (blank) atoms or molecule

Biology
1 answer:
Rasek [7]3 years ago
5 0

Answer:

four

Explanation:

carbon has 4 valence electrons so it can bond with up to 4 other atoms to get  its octet.

You might be interested in
Consider the following planned experiment.
Vitek1552 [10]

Answer:

B

Explanation:

the size of pot is given two sizes, large and small, whereas the rest are the same therefore, the size of pot is being tested

7 0
3 years ago
A solution of acetic acid is prepared in water by adding 11.1 g of sodium acetate to a volumetric flask and brining in the volum
velikii [3]

Answer:

The concentration of

the Acetic Acid is 0.0325M

the Sodium Acetate is 0.1028M

Explanation:

Given

The dissociation of acetic acid is

CH3COOH + CH3COO- + H+ + HA -> A- + H+

We calculate the molarity of sodium acetate by using

Molarity = Moles/Volume

The formula weight of sodium acetate is 82.03 g/mol.

Moles = 11.1g/82.03g/mol

= 0.1353M

Since the volume is 1L, the molarity of sodium acetate will still be 0.1353M

The starting concentration of sodium acetate is 0.1353M

The final concentration of sodium acetate is the starting amount of sodium acetate, minus the amount that was protonated.

Assume that, x = concentration of acetic acid, which is the amount of sodium acetate that was protonated.

From the Henderson-Hasselbalch equation

PH = pKa + log[A-]/[HA]

[A-] = 0.1353 - x

[HA] = x

pKa = 4.75

PH = 5.25

Substitute in these values

5.25 = 4.75 + log(0.1353-x)/x

log(0.1353 - x)/x = 5.25 - 4.75

log(0.1353-x)/x = 0.5

log(0.1353 - x)/x = ½

(0.1353-x)/x = 10^½

(0.1353 - x)/x = 3.1623

0.1353 - x = 3.1623x

0.1353 = x + 3.1623x

0.1353 = 4.1623x

x = 0.1353/4.1623

x = 0.0325M

Therefore [HA] = x = 0.0325M

[A-] = 0.1353 - x = 0.1353 - 0.0325 =

[A-] = 0.1028M

8 0
3 years ago
Describe the means by which Hershey and Chase established that only the DNA of a phage enters an E. coli cell. What conclusions
ASHA 777 [7]

Answer:

Harshey and chase labeled T2 bacteriophage with radioactive sulfur and radioactive phosphorus. As DNA contains phosphorus, not protein and protein contain sulfur, not phosphorus, therefore, the presence of radioactivity in cell can determine which is the genetic material .

Then Harshey and Chase infected <em>E.coli</em> with T2 bacteriophage and centrifuged the cell. They found radioactive phosphorus in cell pellet and radioactive sulfur in supernatant.

So by this experiment, they concluded and proved that DNA is the genetic material that gets transfer from one generation to another.

6 0
2 years ago
What type of blood vessel is A
quester [9]
<span>What type of blood vessel is A?
The blood vessel is a artery
It carries blood away from the heart. Hope this helps. :)

</span>
3 0
3 years ago
Read the passage. Then explain the ways humans have influenced the traits in corn plants and the impacts each biotechnology has
myrzilka [38]

Answer:

they have influenced it through genetic engineering

Explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • How are animal and plant cells similar? How are they different? Explain.
    12·2 answers
  • Which is a result of a seasonal change (meaning a change that happens over
    6·1 answer
  • Suppose you were interested in the effect of breastfeeding versus formula feeding on the composition of gut flora in newborns. A
    6·1 answer
  • If you had to select a microorganism that would be capable of killing the entire human population what would it be ? Bacteria, v
    12·1 answer
  • The combining form cutane/o-,as in the word subcutaneous,means ________.
    15·1 answer
  • What are the lipids that contribute to the structure and function of the cell membrane?
    6·1 answer
  • A protein has a molecular mass of 400 kDa when measured by gel filtration. When subjected to gel electrophoresis in the presence
    5·1 answer
  • Are all oxygen atoms the same? And why
    11·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • All of the organisms on earth together with their physical environment comprise the.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!