1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nirvana33 [79]
3 years ago
6

Ashley is taking a test. She has to write why comb jellies and jellyfish belong to two different phyla. What should Ashley write

?
A that jellyfish are vertebrates, while comb jellies are not
B. that jellyfish are mobile, while comb jellies are not
C. that jellyfish have stinging cells, while comb jellies do not
D.
that jellyfish have an exoskeleton, while comb jellies do not​
Biology
1 answer:
Juliette [100K]3 years ago
6 0

Answer: C. That jellyfish have stinging cells, while comb jellies do not

Explanation:

Comb Jellies to the untrained eye are the same as Jellyfish but as the question says, they are different in that they belong to different phyla.

The Comb Kelly belongs to the Ctenophora Phylum while the Jellyfish belongs to the Coelenterate phylum.

Perhaps the largest difference between them is that Ctenophora do not have stinging cells as opposed to members of the Coelenterate Phylum that do.

You might be interested in
Please answer!! i need help so bad. please!!!
padilas [110]

The purple kernel is dominant over the yellow kernel and hence it has the genotype of homozygous dominant PP.

<h3>What is Genotype?</h3>

Genotype may be defined as the ultimate combination of alleles of genes that are selected for specific studies.

If it has some offspring with purple kernels and some with yellow, the genotypes of the two parents are heterozygous dominant for the purple kernel, i.e. Pp and Pp.

And when these two parents are crossed with each other, the genotypes are PP, Pp, Pp, and pp. While the genotypic ratio is 1:2:1 (PP: Pp: pp), but the phenotypic ratio is 3:1 (Purple: Yellow).

Therefore, it is well described above.

To learn more about Kernel color in Corn, refer to the link:

brainly.com/question/1638810

#SPJ1

4 0
2 years ago
Name six kind of seedless plants
irakobra [83]
Ferns<span>, </span>horsetails<span>, </span>mosses<span>, and </span><span>liverworts, flowers, mint</span>
5 0
3 years ago
How pollution from burning fossil fuels in vehicles can be reduced
Drupady [299]

Explanation:

Incinerators are not helpful in reducing pollution as they produce a lot of ash and smoke so it increases the air pollution by burning of waste.

Solar and wind energy are the clean source of energies replacing the fuels. Catalytic converters reduce the air pollution from the exhaust fumes of vehicles.

❤️❤️✌️

7 0
3 years ago
Which protist is not correctly linked to the type of movement it shows?
Sergio [31]

Answer:

Sporozoa-flexing the pellicle

Explanation:

Sporozoa do not have flagella, cilia, or pseudopodia and they show gliding movement, amoeboids show movement by pseudopodia, ciliates by cilia and zooflagellates show by flagella, the pellicle is shown by paramecium.

So, the correct option is 'Sporozoa-flexing the pellicle'.

5 0
3 years ago
What plant organ captures the most solar energy to power photosynthesis
Minchanka [31]

Answer:

leaves capture the most solar energy to power photosynthesis

4 0
3 years ago
Other questions:
  • Which statement regarding ATP is false? Compared with other phosphate‑containing compounds in biochemistry, ATP has a higher fre
    8·1 answer
  • State two ways in which a single-celled organism, such as amoeba and a human body cell are alike
    14·1 answer
  • Which type of rock forms as a result of cooling and crystallization?
    10·1 answer
  • During photosynthesis, ___________ energy is converted into ____________ energy.
    15·1 answer
  • What cycles on earth does Solar radiation fuel?
    7·1 answer
  • What will a hypothesis become if it is supported by repeated
    7·1 answer
  • People who live in tundra, will get more vitamin D. True or False.
    8·1 answer
  • HELPP ASAP !! <br> DUE TODAY !!
    15·2 answers
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • Where in my body is the original cell from which I was formed?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!