1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Salsk061 [2.6K]
3 years ago
5

What does Arrow's theorem teach us about Democratic elections?

Law
1 answer:
NARA [144]3 years ago
4 0
Everyone gets a say, everyone has a voice even if u can’t speak, also it’s a fair choice on elections
You might be interested in
Which is true about Plato’s Five Regimes of human government?
Goryan [66]

Answer:

Jesus loves you

3 0
3 years ago
According to the gideon v. wainwright case, what was gideon denied during his court proceedings ?
Sonbull [250]

Answer:

At trial, Gideon appeared in court without an attorney. In open court, he asked the judge to appoint counsel for him because he could not afford an attorney. The trial judge denied Gideon’s request because Florida law only permitted appointment of counsel for poor defendants charged with capital offenses.

Explanation:

Hope this helps :)

3 0
3 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
Discuss and explain your expectations as to how the police
Paladinen [302]

Answer:

Since the United States was established there was always a great importance to maintain a relationship between both the states and the nation, both politically and economically. In the late 1700's to the early 1800's, George Washington's treasurer, Alexander Hamilton, had opted for a "Bank of the United States", which was fully within Congress's authority. He was wanting the bank to circulate and print paper money and expand economic development. This was eventually signed into legislation and a national government was created. The Bank taxed both the states and the nation as a whole. The Secretary of State, Thomas Jefferson, did not support the national bank nor did his supporters, the Jefferson Democratic-Republicans. The bank's charter expired in 1811, and the supporters along with Jefferson wanted to block its renewal. This lead to various questions and conflicts such as "Could Congress charter a national bank?" or "Could the federal government tax the states?" The Barron vs Baltimore case ("James McCulloch, an agent for the Baltimore branch of the Second Bank, refused to pay a tax that Maryland had imposed on all out-of-state chartered banks") declared that the Bill of Rights could NOT restrict the powers of the state governments. After this, there was a rise of dual federalism. Dual federalism was the states and national government exercising exclusive authority in distinctly delineated spheres of jurisdiction. Then there was a rise of cooperative federalism, which was when both levels of government coordinated their actions to solve national problems, such as the Great Depression. Then came an era of new federalism which is what the nation uses today. By decentralizing policies, authority can blend between the national, state and local governments.

Explanation:

3 0
3 years ago
Even before the 19th Amendment was passed by the federal government, why do you think some states passed state laws allowing wom
Rudik [331]

Answer:

People still to this time are against women rights and women didn't have much opportunities as men which is not fair everybody should be equal even if you are a women or a men

5 0
3 years ago
Other questions:
  • Hi lolll how are yoi
    9·2 answers
  • What regulation covers the wearing of the uniform?
    6·1 answer
  • "Did the appellate court agree with the trial court's order that Case Western must issue a diploma to Amir Al-Dabagh
    10·1 answer
  • Don't eat garbage is a law or no?
    10·1 answer
  • What is the Right to Privacy
    8·1 answer
  • What was historically significant about Mosaic Law?
    10·2 answers
  • During the _____ Era, concerned citizens tried to reform society and make drug makers accountable to consumers.
    5·1 answer
  • Why are private businesses simpler to operate than public companies?
    15·1 answer
  • Select the correct answer.
    9·2 answers
  • Average yearly salary for a private detective
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!