All categories

3 years ago

Once you have been exposed to an antigen, you develop immunity against the same antigen because

1 answer:

3 0

Because an antibody is "made" relative to the antigen, but kept at low levels when you are exposed the first time ("primary immune response"). The second time you're exposed to the same antigen, memory cells recognize it and the body produces a high level of antibodies, and the level of antibodies usually remains higher for a longer time ("secondary immune response"). This is your basic immune response (primary and secondary).

This explains exactly why vaccines are effective to extremely effective.

You might be interested in

The control and experimental groups are designed to be identical<br><br> True or false

NARA [144]

False would be your answer

4 0

4 years ago

Read 2 more answers

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

3 years ago

Question in link below.

bezimeni [28]

The correct answer is - They supply the energy needed for living processes.

Both the carbon and the nitrogen, are gases that are crucial for the survival of the organisms on the planet. They are mostly used by the producers in the ecosystems, as they need them to manage to perform their cycles, get nutrition, and of course energy. The producers are the basis of the ecosystems, so if they do not have a healthy supply of carbon and nitrogen, the ecosystems on the whole planet will collapse. The carbon and the nitrogen later go from one organism to another as the energy is transferred, and usually end up back into the atmosphere again.

4 0

3 years ago

What do dna, proteins, and fats have in common? what do dna, proteins, and fats have in common? they are polar. they contain pho

serg [7]

They all contain carbonyl groups. DNA has carbonyl groups in it's nucleotide ring structures. Every amino acid in a protein has a carbonyl group in its backbone structure. Fats too have carbonyl groups in their structures attached to hydrocarbon chains

4 0

4 years ago

What causes the sinking of water in the northern Atlantic Ocean, which helps to drive the Ocean Conveyor Belt?

Kobotan [32]

Answer:

a.)

Explanation:

The dense cold salty water from the south sinks to the bottom of the ocean.

6 0

3 years ago