1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ICE Princess25 [194]
3 years ago
5

Of the acids in the table below, ________ is the strongest acid. question 6 options:

Biology
1 answer:
Black_prince [1.1K]3 years ago
5 0
Thea answer is........... C hcho2
You might be interested in
Should private industries be able to pay scientists to perform their product safety studies? Why or why not?
erica [24]
So base on the question, I would only say YES, because and experiment must be done in a safe place with a professionals and more importantly it would be safe to all including the people around the factory. I hope you are satisfied with my answer and feel free to ask for more 
6 0
3 years ago
Read 2 more answers
Plant cells use photosynthesis to make the organic compounds that their mitochondria and other organelles need. Where do you thi
chubhunter [2.5K]

Answer:

The animal cells get the organic compounds by eating plants. The only form of energy a cell can use is a molecule called adenosine triphosphate (ATP). Chemical energy is stored in the bonds that hold the molecule together.

Explanation:

5 0
3 years ago
Read 2 more answers
A toy robot can walk,talk because of batteries. What type of energy is stored in the batteries
BartSMP [9]
Chemical energy is stored in the battery cells and converted to electrical energy when it's needed by the toy robot
3 0
3 years ago
Read 2 more answers
Classify each process as weathering and erosion.
kobusy [5.1K]
Two on bottom are erosion and the top left one.   the other two on top are weathering
6 0
3 years ago
Read 2 more answers
The deep smooth areas of the ocean floor are known as
Hoochie [10]
I think the answer to this is abyssal plane 
7 0
4 years ago
Read 2 more answers
Other questions:
  • ​the production of sterile mules by interbreeding between female horses (mares) and male donkeys (jacks) is an example of
    7·1 answer
  • All the alleles present in all individuals in a species are referred to as the ____________ of that species.
    14·1 answer
  • Which of the following statements about matter is false?
    5·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • In determining whether a particular act occurred within the scope of employment, courts will evaluate whether the employee’s act
    9·2 answers
  • If a mutation in a gene allows a protein to function more efficiently, the resulting
    11·1 answer
  • 4. Compare a male to a female frog. How can you tell the difference?​
    15·2 answers
  • Most of the rocks we study were formed in what era?
    14·1 answer
  • Does anyone know this one please help me stuck on it
    5·2 answers
  • imagine that you could treat chloroplats with an indiicator dye that turns red in acidic conditions, yellow in neutral ocndition
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!