1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SOVA2 [1]
3 years ago
15

What is the job of a nuclear membrane

Biology
1 answer:
Pie3 years ago
6 0
The nuclear membrane keeps the nucleus from geting damaged
You might be interested in
Consider a population of frogs. Allele B1 codes for spotted frogs; allele B2 codes for non-spotted frogs. B1 is dominant to B2 .
oee [108]

Answer:

Frequency of B1 = 0.47

Frequency of B2 = 0.53

Hope this helps!

4 0
4 years ago
Read 2 more answers
NEED HELP!!!! A ______ is used to measure air pressure. barometer, temperature guage, tiltmeter, hydrometer
astra-53 [7]
I believe it is a Barometer
7 0
3 years ago
Read 2 more answers
The scientific method provides the framework for all scientific research, including nutrition science. Choose the statement belo
Andrews [41]

Answer:

1) d. observe phenomenon; generate hypothesis, conduct experiment, accept, reject, or modify hypothesis.

C. A study that compares a aroup of people with diabetes to a similar aroup of people without diabetes is an example of a case-control study.

Explanation:

Scientific method is a step by step procedure ranging from observing a problem to actual experimentation that aims at investigating a problem. The steps involved in the scientific method are as follows:

a)observe phenomenon; This precedes every experiment in the scientific method.

b) generate hypothesis: This is a testable explanation given as a possible solution to the observed problem.

c) conduct experiment: The hypothesis is tested via experimentation.

d) accept, reject, or modify hypothesis: Based on the result of the experiment, the hypothesis can be rejected, accepted or even modified.

Question 2:

Case control study is a type of study design that uses or compares a group of affected individuals (by a disease) called CASES and unaffected individuals called CONTROL. In this case, A study that compares a group of people with diabetes (cases) to a similar aroup of people without diabetes (control) is an example of a case-control study.

7 0
4 years ago
What homeostatic process requires energy to move particles across the plasma membrane
vovikov84 [41]
Active transport.

Passive transport, being its opposite, requires no energy at all. Therefore, active transport would require energy or ATP in order to move across.

Hope this helps!
7 0
3 years ago
Okay so I've have 10 Brainliest, through my whole time using brainly- I want people to get brainly and points so Im giving away
Kruka [31]
Once again, you’re very kind :)
7 0
3 years ago
Read 2 more answers
Other questions:
  • If Tyler does not eat a diet that include essential amino acids his cells will not be able to bulid
    14·1 answer
  • What is the range for the following set of measurements? 27°C, 12°C, 31°C, 19°C, 23°C, 11°C, 17°C
    8·1 answer
  • This is the role of species in an ecosystem, consisting of such things as what it eats, when it eats, and where it lives.
    11·1 answer
  • Why we dream and when we dream why we remember some of the dream
    9·1 answer
  • Choose one of these hormones: Glucagon, Insulin, or Thyroid hormone.
    11·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Luteinizing hormone stimulates testosterone secretion by the leydig cells of the testes.
    10·1 answer
  • If the number of trees on the planet suddenly decreased, what might happen to
    6·1 answer
  • Which structure controls how much light passes through the specimen? (please help)
    14·2 answers
  • The graph shows the changing levels of hormones during menstruation and ovulation. What happens to hormone levels during ovulati
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!