1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sauron [17]
3 years ago
6

Name the cell that performs phagocytosis.​

Biology
1 answer:
olga55 [171]3 years ago
8 0

Answer:

Thats WBCs cell which perform phagocytosis

You might be interested in
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
What traits could represent the phenotype of an organism ?
vfiekz [6]
The answer would be D yellow, tall
8 0
3 years ago
in which case dd the us supreme court establish the precedent allowing civilians to bring a suit against federal law enforcement
Phoenix [80]

The US supreme court establish the precedent allowing civilians to bring a suit against federal law enforcement officers and other government employees under 42 US section C 1983 during the case of WEBSTER BIVENS VS 6 UNNAMED FBI AGENTS and suit against federal law enforcement.

<h3>What is the law under 42 US section C of 1983?</h3>

Section C of 1983 gives individuals the right to sue the federal and state government employees and law enforcement officers acting under color of state law for violations of their civil rights.

For this section, its purpose was derived from the case between Webster Bivens and 6 unnamed FBI agents after a complaint that these agents made a warrantless entry to search his apartment.

Learn more on US federal laws here: brainly.com/question/25912245

#SPJ1

5 0
1 year ago
Which statement about how organisms depend on abiotic factors in an aquatic ecosystem is not true?
Nat2105 [25]
The answer is <span>a. most living organisms can survive in environments with several different temperature and salinity levels.

</span>Aquatic plants and animals depend on dissolved oxygen for respiration. The other abiotic factors that impact their life in an aquatic ecosystem are temperature, salinity, and flow and they determine the quality of their life. <u>It is not true that most living organisms can survive in environments with several different temperature and salinity levels.</u> On the contrary, a few species can live in <span>environments with several different temperature and salinity levels, for example, some bacteria. The most organism can survive in a specific range of abiotic factors.</span>
5 0
3 years ago
Read 2 more answers
Which layer does temperature zone does most precipitation occur?
siniylev [52]

Answer:

troposphere

Explanation:

The troposphere is the temperature zone of the atmosphere where most precipitation occurs. It has a normal temperature of 0 degrees Celsius. This layer is where the majority of weather events take place. It is 10–15 kilometers thick above the Earth's surface.

5 0
3 years ago
Other questions:
  • What prefix before saccharide would you use to describe sucrose
    10·1 answer
  • The main goal of cellular respiration is the production of molecules.? A) ADP
    7·1 answer
  • What is the meaning of life? Our science teacher asked us this
    11·2 answers
  • What characteristics of living things does a river have?
    6·1 answer
  • Any orgamism or particle that can cause an infectious disease?
    5·1 answer
  • Animals who can control the direction they move and all have what
    12·1 answer
  • Which would be the best tools to measure the density of a small piece of silver ore
    15·1 answer
  • Rational design requires:
    13·2 answers
  • What is fermentation ?<br>?​
    12·2 answers
  • The classification of organisms is called (1 point)
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!