1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Roman55 [17]
3 years ago
11

Malonate is a competitive inhibitor of succinate dehydrogenase. If malonate is added to a mitochondrial preparation that is oxid

izing pyruvate as a substrate, which of the following compounds would you expect to initially decrease in concentration?A) Citrate
B) Fumarate
C) Isocitrate
D) Pyruvate
E) Succinate
Biology
1 answer:
Monica [59]3 years ago
8 0
<h2>B) is the correct option </h2>

Explanation:

  • Succinate dehydrogenase is the smallest component of electron transport chain and consists of four different subunits including FAD, 3 Fe-S centers
  • It catalyzes oxidation of succinate to fumarate and electrons released transferred to ubiquinone
  • Succinate dehydogenase transfer electrons from succinate to ubiquinone via FADH2 thus this complex directly links tricarboxylic acid cycle to electron transport chain
  • Activity of succinate dehydrogenase is inhibited by malonate which is a competitive inhibitor as a result oxidation of succinate to fumarate will not occur and hence concentration of fumarate will decrease  
You might be interested in
Predict what the effect of a powerful fungicide that killed almost all fungi have on humans and animals. The humans and animals
tangare [24]
B. The amount of waste would build up and the toxins produced would harm the animals and humans
8 0
3 years ago
Between which two atoms of water are hydrogen bonds are formed?
IgorC [24]
A: between the hydrogen atom of one water molecule and the oxygen atom of another
7 0
3 years ago
Which structure is responsible for controlling substances that enter and leave the cell?
maria [59]

Answer:

Cell Membrane

Explanation:

3 0
2 years ago
Scientist involved in biotechnology sometimes insert the dna of one organism into a second organism what is the purpose of this
Montano1993 [528]

In biotechnology, the process of introducing the foreing DNA into a cell by a virus is called transduction.Gene therapy is one of the purposes of this process.

5 0
3 years ago
Which is not a plate?
never [62]
Um, can you please elaborate a little bit more.
4 0
2 years ago
Other questions:
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • I WILL GIVE U BRAINLEST what has hands but can’t clap
    10·2 answers
  • If one of the functions of the capillaries is to supply body cells with oxygen and nutrients, you would expect the capillary wal
    14·1 answer
  • Which of these is an environmental effect of building dams?
    10·2 answers
  • PLEASE PLEASE HELP!!!
    7·1 answer
  • What is peer review? Why is it important? (Site 1)
    5·1 answer
  • When an individual moves into one population from a different population,it is called
    8·1 answer
  • Why are health authorities concerned when the vaccination rates for an infectious disease fall?
    7·1 answer
  • How did the team determine that the body was placed in a woodchipper?
    9·1 answer
  • Please help me. Giving 15 points if you help.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!