1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aev [14]
2 years ago
15

After several miles of running and sprinting in intervals, the runner’s muscles ache and feel fatigued. Which is the best explan

ation for what has occurred?
Biology
1 answer:
marysya [2.9K]2 years ago
8 0
Well the best explanation for what has happened the muscles don't see much exercise so they grow tiered quicker than normal
You might be interested in
If today is Monday and it is a 1st quarter moon, what phase will it be on Thursday
Rom4ik [11]

Answer:

Saturday

Explanation:

because

3 0
2 years ago
In which type of human cell(s) would 46 chromosomes be located? Select all that apply.A. diploidB. eggC. somaticD. gameteE. sper
Marrrta [24]

Answer:

A. diploid and C. somatic

Explanation:

Humans are diploid organisms and have 23 pair of chromosomes i.e. in total humans have 46 chromosomes.

There are 2 types of cells in humans (1) somatic cells and (2) germ cells.

Somatic cells are normal body cells which are diploid and have all 23 pairs of chromosomes. But, germ cells are special type of cells which are produced by gonads (sex organs). Germ cells are also known as gametes. In females, ovary is the sex organ which produces germ cells named as egg cells while in males testes is the sex organ which produces germ cells named as sperms. Germ cells (egg and sperm) are haploid cells which fuse to form a zygote which is the first cell of next generation. The process of fusion of egg and sperm is known as fertilization which is responsible for restoring diploidy in the progeny which receives half the genetic material from female parent and half the genetic material from male parent.

6 0
3 years ago
Which environment is most likely to be characterized by dry scrub with frequent fires?
Katyanochek1 [597]

Environments likely to be characterized by the presence of dry scrubs and frequent wildfires are those that lack the presence of rain and suffer high sunlight hours.

When referring to the terrestrial biomes that meet the characteristics described, we can include:

  • <u>Temperate grasslands</u>
  • <u>Cold deserts</u>

The temperate grassland/cold desert biomes have:

  • cold and dry winters
  • hot, dry summers
  • Extended sunlight hours

This biome is very dry, and the harsh weather makes it difficult for plants to grow, leading to their <em>dry scrub</em> characteristic. This biome also experiences frequent wildfires due to the <u>intense sunlight and lack of rain to which it is exposed.</u>

To learn more visit:

brainly.com/question/11839824?referrer=searchResults

4 0
2 years ago
Can you help me d d d d d d d dd d dd d dd d d d d
Eduardwww [97]

Answer:

D

Explanation:

It's kind of hard to explain, if it's hot, it's the temperature.

The Answer was in your question. :)

5 0
3 years ago
Read 2 more answers
Which of the following would you predict to be the most likely outcome if lumber companies were to cut only some of the trees do
Ksju [112]
I'm just guessing since this is my prediction. Either B. or D. I dont know about C. and it is definitely not A. since the lumber companies are only taking down some trees instead of all of them.
7 0
3 years ago
Other questions:
  • Why is it so important to properly don and remove personal protective equipment?
    14·1 answer
  • Random changes in allele frequency in a population are called:
    8·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • ¿Cual es la técnica que se utiliza para identificar si una mezcla es una solución?
    13·1 answer
  • Eology belongs to which main category of science?
    15·1 answer
  • These bacteria change the nitrogen in the atmosphere into a form that we can use to make proteins
    13·1 answer
  • Please help ASAP 65 POINTS IF YOU GET IT RIGHT!!!
    11·2 answers
  • How does the development of a bluebird compare to that of a frog?
    13·1 answer
  • PLEASE HELP QUICK!!!
    14·2 answers
  • What evidence suggests that the populations of paramecia affect each other
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!