1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Murrr4er [49]
3 years ago
15

Why are some people shy?

Biology
1 answer:
pochemuha3 years ago
6 0

Because people are mean these days man

You might be interested in
Which is the largest group of organisms that can interbreed?
irakobra [83]
Population I suppose?
3 0
3 years ago
Read 2 more answers
A man and woman are deciding whether to have a child. The genotype of
LUCKY_DIMON [66]

Answer:

No, the child cannot inherit the disease.

Explanation:

The problem tells you that the man has a recessive allele for an inherited disease, but he has a normal phenotype. This means that the disease is recessive and in order for an individual to have the disease, they must have two recessive copies of the allele. The problem also tells you that the mother has a genotype that does not include this allele. With this information, you can do a punnet cross of BB (mother) x Bb (carrier father), and end up with the following possible genotypes: BB, Bb, BB, Bb. Therefore the child will not have the disease, but there is a 50% chance that the child will be a carrier for the disease.

3 0
3 years ago
When the animal cells undergo cell division, several cellular structures aid the movement of chromosomes into the two new daught
Nitella [24]

i pretty sure its Cytokinesis and Spindle Fibers.


3 0
3 years ago
Do you think that in the human species, there are psychological traits such as empathy, aggression, intellect, imagination, etc.
WARRIOR [948]

Answer:

each sex has these traits, but with some, like aggression, I feel can be more "biased", so to speak, to the male sex

Explanation:

5 0
3 years ago
Compared to its surroundings, the concentration of solutes is low inside a cell so, the cell is in a hypertonic, hypotonic or is
Kazeer [188]

Answer:

The cell is in a hypertonic solution.

Explanation:

The solution is hypertonic because the amount of solute(s) is higher outside of the cell than it is inside the cell, so the solvent (e.g. water) would move from the cell to the solution in order to obtain equilibrium between the two.

7 0
3 years ago
Other questions:
  • Smog complex is: an atmospheric condition during which a warm layer of air stalls above a cool layer the precipitation of acidic
    14·1 answer
  • A mixed reference "locks" one part of the cell reference while the other part can change. _______________
    7·1 answer
  • ¿CÓMO FUNCIONA LA EVOLUCIÓN?
    7·1 answer
  • Which diuretic remains effective when creatinine clearance drops below 25 ml/min?
    9·1 answer
  • Why do boreal forests have large reserves of organic carbon?
    8·1 answer
  • In a diploid invertebrate, genes d and e are closely linked. single crossovers between these two genes occur only in one out of
    8·1 answer
  • Some species of dolphins find their prey by echolocation; they emit clicking sounds and listen for echoes returning from distant
    13·1 answer
  • Who is credited whit creating the first Accurate model of dna
    7·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Which is the correct net ionic equation for the reaction of AgNO3 and CaCl2?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!