1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
WARRIOR [948]
3 years ago
7

In the year 2500, five male space colonists and five female space colonists (all unrelated to each other) settle on an uninhabit

ed Earthlike planet in the Andromeda galaxy. The colonists and their offspring randomly mate for generations. All 10 of the original colonists had free earlobes, and 2 were heterozygous for that trait. The allele for free earlobes is dominant to the allele for attached earlobes. Which of these is closest to the allele frequency in the founding population?
a. 0.1 a, 0.9 A
b. 0.2 a, 0.8 A
c. 0.5a, 0.5 A
d. 0.8 a, 0.2 A
e. 0.4 a, 0.6 A
Biology
1 answer:
const2013 [10]3 years ago
3 0
C. O.5a and 0.5 A

Hope this helps!!
You might be interested in
What color are chthamaluis?​
alexandr402 [8]

Answer:

there like brown grayish color

5 0
3 years ago
Read 2 more answers
Scientists agree that changes in atmospheric gases may what?
Furkat [3]
Destroy the ozone layer
5 0
3 years ago
Read 2 more answers
Which statement is most likely to apply to a cell that has DNA within its cytoplasm?
mars1129 [50]
 A cell that has DNA suspended in cytoplasm and not a nucleus is most likely a prokaryote, which have small DNA clusters called nucleoids
7 0
4 years ago
Read 2 more answers
You observe a plant on your windowsill that is growing at an angle toward the outside. This is an example of a living thing ____
katrin2010 [14]

Answer:

response to stimuli / tropism

Explanation:

The plants and animals always respond to stimuli. It is an innate character of all living things. When a bright light falls on the eye, it closes immediately. This is responding to the stimuli. When someone touches the leaves of touch-me-not plants it closes its leaves due to the external stimuli.

The plants respond to the light. Because it does photosynthesis in the presence of light. Therefore, the leaves and branches of the plants always bend towards the light. This process is called phototropism.

Similarly, the roots of the plants move towards gravity under the ground. This is called geotropism.

Besides phototropism and geotropism, other types of stimuli are there - hydrotropism(response to the water), chemotropism(response to certain chemicals).

That's why the plants growing on the windowsill move towards outside where light comes.

7 0
3 years ago
How are cancer therapies tailored to nucleotide synthesis -explain using the example of fluorouracil and methotrexate.
nika2105 [10]

Answer:

By preventing the synthesis of DNA halting cell growth.

Explanation:

Fluorouracil and methotraxate prevent the synthesis of the neucleoside Thymidine thus preventing DNA replication and elongation. Methotraxate has a structure analogous to Folic acid which is important for thymidine synthesis. Thus, it acts as a competitive inhibitor on dihdrofolate reductase an enzyme that is essential for tetrahydrofolate formation, a folic acid derivative.

Fluorouracil acts by inhibiting thymidylate synthase which catalyses an essential step in Thymidine synthesis.

3 0
4 years ago
Other questions:
  • What are the "twisty columns" and "rungs" in the DNA?
    13·2 answers
  • Describe why scientist monitor the pH of a lake ?
    12·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Some single-celled organisms make copies of themselves through mitosis. Which decribes the function of the cell cycle in such si
    15·1 answer
  • You can tell the age of a skeleton by looking at:
    7·1 answer
  • 10 A. How many years would pass if only 25% of the Potassium-40 radioactive elements are left?
    12·1 answer
  • Drag each tile to the correct location on the image.
    8·1 answer
  • What are the 2 types of cells (not plant and animal)?
    14·2 answers
  • How are herbivores and carnivores the same?
    5·1 answer
  • Name five dygestive enzymes secreted by the intestinal glands​
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!