1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
NeTakaya
4 years ago
13

In which phase of cell cycle does synthesis of DNA take place?

Biology
2 answers:
Sholpan [36]4 years ago
8 0

Answer:

The correct answer for this question would be the S phase of the cell cycle. During the S phase, DNA is synthesised in the form of a complete copy, which is stored in the nucleus, as well as acting as a copy for a microtubule-organising structure referred to as the centrosome.

Explanation:

Aleksandr-060686 [28]4 years ago
6 0
<span>The correct answer for this question would be the S phase of the cell cycle. During the S phase, DNA is synthesised in the form of a complete copy, which is stored in the nucleus, as well as acting as a copy for a microtubule-organising structure referred to as the centrosome.</span>
You might be interested in
Identify the two minerals shown that exhibit fracture as a dominant form of breakage
bazaltina [42]
Two minerals that exhibit fracture as a dominate form of breakage are quartz and olivine. <span />
4 0
3 years ago
What is one of the causes of mechanical weathering?
neonofarm [45]
Carbon dioxide hopefully I think ❤️
3 0
3 years ago
I need 10 interesting facts about Oviraptor? Please
Norma-Jean [14]
Oviraptor means "egg theif"

Oviraptors could have 20 eggs at a time

They lived in Mongolia

The aren't necessarily true raptors

Oviraptors were about 6 - 8 feet tall

The first oviraptor was found in 1924 (i believe)

Oviraptors lived in the Cretaceous period.

Oviraptors most likely weighed 60 - 70 pounds.

They were renamed, as "ovinutrix"

The first fossil of oviraptors was found with eggs.

Brainliest please?


6 0
3 years ago
Siblings will have the same nuclear DNA, but different mtDNA.<br> True<br> False
Katen [24]

Answer:true

Explanation:

8 0
3 years ago
Classify each nutrient as a macronutrient or as a micronutrient
levacccp [35]

Answer:

Macro: Phosphorous, Protein, Fat, Carbohydrates

Micro: Vitamin A, Sodium

Explanation:

Macronutrients are nutrients that are needed in large amounts. Micronutrients are needed in smaller amounts.

6 0
4 years ago
Other questions:
  • Discuss how climate change, overpopulation, or a local environmental issue may have impacted land or aquatic biomes.  Was the im
    8·1 answer
  • What is the primary function of the lymphatic system
    10·1 answer
  • Members of two different species possess a similar-looking structure that they use in a similar way to perform about the same fu
    10·1 answer
  • New regulations for how Australia, New Zealand and other countries in Oceania manage economic growth and protecting natural reso
    5·1 answer
  • Which area of the graph shows the activation energy required if an enzyme was not present
    13·1 answer
  • The digastric muscle’s job
    14·1 answer
  • If the Moon had oceans would there be tides similar to what we<br> experience on Earth? Explain.
    8·2 answers
  • What is the diploid number of chromosomes in the cells shown in the animation of mitosis?
    14·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • A small part of a population is relocated to a completely new environment. Since only a few individual are moved, the gene pool
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!