1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nesterboy [21]
3 years ago
11

Which of the following is not a carbohydrate?

Biology
2 answers:
Marianna [84]3 years ago
5 0
I believe the answer is A, Cholesterol.
natali 33 [55]3 years ago
5 0

The correct answer is A. cholesterol

You might be interested in
The cell membrane serves many functions. One of the cell membrane's functions is to help the cell maintain homeostasis. Which of
borishaifa [10]

the internal environment is the interstitial fluid that is around each and every cell, then homeostasis has more to do with what is outside of a cell than what is inside of it.

5 0
3 years ago
After fertilization cells as seen here divide repeatedly. The next step in the development of a multicellular organism would be?
Nataly [62]
C.) Differentiation. Hope this helps (;
3 0
3 years ago
Read 2 more answers
What positive effect might a rainstorm have in the long term?
OLEGan [10]
 all the plants will be replenished
3 0
3 years ago
Examine the diagram below, which shows stages in the water cycle.
Lesechka [4]

Answer:

A. accumulation

Explanation:

Precipitation is where water falls back to the surface of the earth through rain, snow, hail, etc.

Evaporation is where water heats up and turns into a gas.

Condensation is when the water cools down and turns to liquid.

3 0
3 years ago
Read 2 more answers
Name and/or describe as many human body systems as you can. what is the function of each body system and what are some of the ma
Travka [436]

Answer:

The endocrine system is a collection of specialised organs (endocrine glands) scattered throughout the body that act to produce hormones.

Explanation:

3 0
1 year ago
Other questions:
  • A patient has recently been diagnosed with an acoustic neuroma. the nurse helps the patient understand that:
    10·1 answer
  • A single lunar cycle lasts a <br><br>1.day<br>2.week<br>3.month<br>4.year
    6·1 answer
  • Volcanic domes commonly are partially destroyed when
    10·1 answer
  • The process of actual separation of cells at the end of mitosis is called _____.
    13·1 answer
  • The corticobulbar motor tract begins in the _____ and ends in the _____. spinal cord, brainstem cortex, brain stem brainstem, sp
    9·1 answer
  • .Sea and land breezes over a large region that change direction with the season are called _____.
    5·1 answer
  • How has the energy of ocean waves altered the beach pictured above? A. It has caused the shoreline to erode. B. It has increased
    7·1 answer
  • What substance does not come from petroleum
    8·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Fleas and mosquitoes sometimes transmit disease pathogens such as bacteria and viruses from one individual to another. Such agen
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!