1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
denpristay [2]
3 years ago
5

NEED ASAP !!!!!

Biology
2 answers:
Anton [14]3 years ago
5 0
The answer is, A.low pressure, high winds, high precipitation. Hope this helps!
Anni [7]3 years ago
4 0
The answer is, <span>A.low pressure, high winds, high precipitation</span>
You might be interested in
What is an organelle
Basile [38]

Answer:

any of a number of organized or specialized structures within a living cell.

Explanation:

Thanks for letting me help!!

7 0
2 years ago
Read 2 more answers
What do our electric magnetic waves have in common
zhannawk [14.2K]
They are able to travel in a vacuum at the same speed.
Hope it helps
7 0
3 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
2 years ago
The desert and tundra are alike because they both have A) extreme daily temperature changes. B) large seasonal variation. C) lim
Ostrovityanka [42]
The desert and tundra are alike because they both have limited available water. 
4 0
3 years ago
Read 2 more answers
When mites or fleas live in a dog's fur, what type of relationship is it?
sleet_krkn [62]
I believe the answer is (B) Parasitic.
6 0
2 years ago
Other questions:
  • A punnet square predicts a 9:3:3:1 ratio for phenotypes. Explain what that ratio means..
    7·1 answer
  • Scientists have created trains that use magnets to make the trains float above the tracks as they travel. the trains float becau
    11·1 answer
  • Enzymes are protein molecules, which are made of long chains of
    12·1 answer
  • Using the food web below determine how many omnivores are present.​
    12·1 answer
  • 346 56
    6·2 answers
  • Why do you think William Morgan invented the sport mintonette? what do you think is the purpose?​
    10·1 answer
  • These three questions hard asab​
    7·1 answer
  • So why do cats have tails
    8·1 answer
  • If someone adds thousands of small fish to a lake, how would the number of big fish<br> change?
    9·1 answer
  • Someone pls pls help for 30 points
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!