1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andrezito [222]
3 years ago
10

I need to know soon someone please help

Biology
1 answer:
Elena-2011 [213]3 years ago
6 0

Answer:observant analytical understanding of nature and communicative

i hope this is helpful

You might be interested in
Besides glucose what other kinds of molecules can be used to produce ATP in cellular respiration?
Makovka662 [10]
Lipids, carbs, and protein
4 0
3 years ago
Read 2 more answers
Describe how the body uses negative feedback to regulate body temperate.
myrzilka [38]

Hope it helps yah (◕ᴗ◕✿)

7 0
3 years ago
Create a “why” type of questions that relate to the interactions of the four subsystem of the earth.
guajiro [1.7K]

1. Why hydrosphere is important for the living organisms?

2. Why atmosphere is important for the living organisms?

3. Why lithosphere is important for the living organisms?

4. Why biosphere is important for the living organisms?

These are the four questions related to the subsystem of the earth. There are four subsystem of the earth named "lithosphere" which means the land, "hydrosphere" which means water, "biosphere" which means living things and "atmosphere" which means air.

All these subsystems are important for the survival of living creatures on the planet earth because all living organisms depends on these four subsystem.

Learn more: brainly.com/question/24579841

3 0
2 years ago
Organisms are placed into kingdoms based on...<br> Their type of
Roman55 [17]
Based on their cell type, their ability to make food, and the number of cells in their bodies.
5 0
2 years ago
Which process must occur first before any cell division can take place
zubka84 [21]

Interphase. Reason: interphase is the first stage of mitosis but since mitosis is the division of the nucleus prophase is actually the first stage.

4 0
2 years ago
Read 2 more answers
Other questions:
  • Who is most at risk of spinal cord injury because of preexisting degenerative disorders?
    14·1 answer
  • The disease ______________ is characterized by destruction of cns myelin sheaths and the formation of hardened scars. alzheimer'
    5·1 answer
  • What surrounds and houses the spinal cord?
    8·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Lichen are often the first species to colonize an environment during primary succession. In general, the first species to coloni
    8·1 answer
  • What two tissues are found within a vein
    15·2 answers
  • How do reflexes protect from injury
    12·1 answer
  • Which shows a correctly paired DNA molecule ?
    15·1 answer
  • How does the term “selectively permeable” apply to a membrane?
    7·2 answers
  • The construction of wind farms has affected the migratory patterns of some bird populations. Bird populations have be noted to n
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!