1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
atroni [7]
3 years ago
14

Which two of the Sun's layers are often reversed in larger stars?

Biology
1 answer:
Bond [772]3 years ago
6 0
<span>radioactive zone & convection zone i think

</span>
You might be interested in
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Oxygen has an atomic number of 8. The n = 1 energy level has two electrons, and the n = 2 energy level has six electrons. Oxygen
natita [175]
<span>Valence is defined as number of electrons that are present in the outermost orbital. Oxygen is in the 16th column of the periodic table and the total number of valance electrons is determined by units place digit of the column position which is 6 for oxygen. The outermost orbital is the high energy level and there are two in that orbit. So the valance is +2.</span>
4 0
3 years ago
Read 2 more answers
How does land use change as the human population increase
Elina [12.6K]

Answer:

The land becomes less as more house are built as more people are born

4 0
3 years ago
A somatic cell of a ferret contains 40 chromosomes.How many will it have after mitosis?​
adell [148]

Answer:

The answer is it will have 40.

Explanation:

After mitosis the daughter cells have the same amount as the parent cell.

7 0
3 years ago
Read 2 more answers
Si una mujer tuviera una masa de 60 kg, ¿cuál sería su masa en la Luna? (la gravedad de la Luna es de 1,67 m / s2)
leonid [27]

Answer: d

Explanation: just did it on edg

4 0
2 years ago
Other questions:
  • Label the internal structure of the earth
    15·1 answer
  • Shallow groove on the surface of the cortex is called a
    7·1 answer
  • Describe the integumentry system in three words
    10·1 answer
  • 1) Which picture in the diagram would be classified as a prokaryote?
    6·2 answers
  • The surface of the earth is divided into more than 50 large plates.? true or false?
    13·1 answer
  • Explain how signaling pathways are deactivated for transduction parts of a signaling pathway.
    15·1 answer
  • The blood flow through the kidney is special because:.
    5·1 answer
  • Which of the following is true about protein molecules?
    15·1 answer
  • Migration of a random few individuals from one population to a new area to establish a new population is an example of:_________
    12·1 answer
  • Natural chemicals in the brain that produce effects similar to those of morphine and other opium-derived drugs are called.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!