1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
irina [24]
3 years ago
15

Which mission saw the first American spacewalk? A. Apollo B. Gemini C. Mercury D. Skylab

Biology
2 answers:
Sliva [168]3 years ago
8 0

Answer:

B

Explanation:

Gemini

Nataly_w [17]3 years ago
8 0

Answer:

The answer is

<u><em>B. Gemini</em></u>

I swear I did't copy off of the first person

I hope that this is helpful for you

:D

You might be interested in
How did a victim die due to broken clavicle, ankle, metatarsal bones, and had wisdom teeth
Zigmanuir [339]

Answer:

Fracture of the lower jaw following tooth extraction is a rare and severe complication, occurring most often in the preangular region following third molar extraction. When left untreated, pseudoarthrosis can occur.

7 0
2 years ago
How many amino acids would be included in the polypeptide encoded by the following mRNA S'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGG
Katen [24]

Answer: 7

Explanation: During translation, several codons have special functions which they serve. AUG is called the initiation codon, it signals the beginning of polypeptide synthesis and also codes for methionine in the internal positions. UAA, UAG and UGA are called termination codons because they do not code for any known amino acid. They signal the end of a polypeptide synthesis.

Each codon is made up of three nucleotides. The number of codons between the initiation codon UAG and the termination codon UGA in the mRNA is seven, thereby encoding seven amino acids.

See the attached diagram for further illustration.

4 0
3 years ago
What leads to genetic recombination in Archaebacteria?
lozanna [386]

Answer:

Binary Fission I believe.

5 0
3 years ago
Which is a strong synthetic polymer that can be used to make toys and bottles
REY [17]

Answer: polyethylene

Explanation:

i took the quiz and got it right, hope this helped:)

7 0
3 years ago
Read 2 more answers
In order to distinguish the DNA of one person from another, scientists often rely on the presence of short tandem repeats (STRs)
valentinak56 [21]

Answer:

STR can be defined as the short tandem repeats which is generally different in people.

It is unique to the person and have a very slow rate of mutation and because of this property these fragments are stable and predictable.

They have a higher power of discrimination and is highly used in the identification of the human beings. It is used on a regular basis in case of forensic science, for the identification of victims, missing person and other criminal cases.

7 0
3 years ago
Other questions:
  • What is independent variable in do wounds heal faster when they are covered by band-aids?
    12·1 answer
  • What sentence best supports the statement that hormones are involved in the regulation of homeostasis? A. The hormone erythropoe
    5·3 answers
  • The forming of sex cells which contain 23 chromosomes is called?
    10·2 answers
  • Which way does earth rotate—from east to west, or west to east? Explain your answer.
    10·2 answers
  • Sea star mollusc and fungus which is closer related to human
    14·1 answer
  • Which one of these is an example of cell division at work?
    6·2 answers
  • The wide variety of species on Earth, whether they are plants, animals, or microscopic organisms, are vital to keeping the world
    7·1 answer
  • You can put A. B. C. or D.<br><br>thank you :)​
    9·1 answer
  • You should carry the microscope with the base in the palm of one hand and the other hand on the arm.
    8·1 answer
  • 2. An ecosystem contains organisms interacting with each other and their physical environment
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!