All categories

3 years ago

PLEASE HURRY!!! Select all answers that apply.For radiometric dating, you need to know which of the following?

Biology

2 answers:

Darina [25.2K]3 years ago

6 0

*The rate at which radioactive decay occurs.
*How much radioactive decay has occurred.

Darina [25.2K]3 years ago

4 0

Answer: Option (1) and (3)

Explanation: Radiometric dating is a very efficient method of dating a rock or fossil or any object. It helps in determining the estimated age of that particular object.

The half-life of all the radioactive methods are already known, so it becomes easy to determine how much decay an object has undergone. So by knowing the rate at which the decay occurs, one can find out the approximate age by using the radioactive decay formula.

Thus, the correct answer is option (1) and (3).

You might be interested in

Cobalamin, more commonly called vitamin b12,

TiliK225 [7]

C. is essential in the synthesis of dna and in the development of red blood cells.

5 0

3 years ago

Which of the following is needed for cellular respiration to occur? (4 points)

Lapatulllka [165]

Answer:

Oxygen

Explanation:

The formula for cellular respiration is oxygen + glucose -> water, carbon dioxide, energy. You can already cross out A and D because they aren't in the formula, so you have two left, water and oxygen. The reason why it is oxygen and not water is because without oxygen you can't even have water. also, I just got this right on my test :-)

6 0

3 years ago

How would you explain the “density of the elephant population” to someone?

cricket20 [7]

Answer:

The most effective experimental approach to assess the effects of elephant impact on vegetation is to assess plant responses under differences in elephant density. It is important that other factors, such as soils or habitat structure are held constant so that the only factor which varies is elephant density.

Explanation:

source: Studying Elephants icun.org

7 0

3 years ago

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

3 years ago

How do proteins determine the traits of an organism?

balandron [24]

Answer:

The traits of a living thing depend on the complex mixture of interacting components inside it. Proteins do much of the chemical work inside cells, so they largely determine what those traits are. But those proteins owe their existence to the DNA (deoxyribonucleic acid), so that is where we must look for the answer

Explanation:

I'm not sure but I hope it's help

6 0

3 years ago