1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Over [174]
3 years ago
13

The fundamental Mendelian process which involves the separation of contrasting genetic elements at the same locus would be calle

d ___.1.segregation2.independent assortment3.continuous variation4.discontinuous variation5.dominance or recessiveness
Biology
1 answer:
Murrr4er [49]3 years ago
6 0

Answer:

1. Segregation

Explanation:

Gregor Mendel, who was an European Monk conducted several experiments whose discoveries formed the basis of understanding inheritance. According to Mendel, parents pass on heritable factors in form of genes to their offsprings and each parent transfers two forms of gene called ALLELE to their offsprings. This allele is the variant form of a gene for a particular trait at a particular locus.

Mendel proposed principles that governs this inheritance and one of them is the LAW OF SEGREGATION, which says that an allele will be randomly distributed or separated into gametes during meiosis or gamete formation i.e. each gamete will possess one form of a gene (allele) for a particular trait.

You might be interested in
Which is true with respect to the kinetic energy of a molecule?
densk [106]

The average kinetic energy of a gas particle is directly proportional to the temperature. An increase in temperature increases the speed in which the gas molecules move.

Hope this helps:)

5 0
3 years ago
Read 2 more answers
What are the characteristics of preganglionic and postganglionic neurons in the autonomic nervous system? check all that apply?
Olenka [21]

Preganglionic Neruons, Conduct impulses from the brain/spinal cord to the ganglion.  Both SNS and PNS preganglionic neurons release Acetylcholine (Ach) as their neurotransmitter and Receptors are Cholinergic.  Postganglionic Neurons conduct impulses from the ganglion to the effector organ or tissue. 

7 0
3 years ago
PLEASE HELP IM BEGGING YOU
Virty [35]
Looks as if the plate faults, with them rubbing against each other and always moving, mountains are created by plates joining together and going upward for them no where to go.
5 0
3 years ago
Read 2 more answers
A DNA sequence that is 15 nucleotides long would give rise into a polypeptide sequence that was how many amino acids long?
Elena-2011 [213]

A DNA sequence that is 15 nucleotides long would normally give rise to a polypeptide sequence that would be 5 amino acids long. This is assuming that all the nucleotides in the DNA sequences are strictly coded to form only sense codons and not a single nonsense codon, also called termination codon

A sense codon is a set of three nucleotides also called a triplet, that codes for a particular amino acid. A DNA sequence of 15 nucleotides has 5 codons.

A nonsense or termination codon is one that does not code for any amino acid. There are three nonsense codons found on mRNA, and these are UAA, UAG and UGA.  So if the DNA sequence has one of these, then the amino acids  in the polypeptide chain will be 4 in number


7 0
3 years ago
Nondisjunction during meiosis results in an abnormal number of chromosomes in one or more gametes. In some cases of nondisjuncti
den301095 [7]

Answer:

haploid (n) or triploid (3n)

Explanation:

If none of the chromosomes separate during meiosis, the resulting gametes will either lack chromosome or have diploid number (2n) of chromosome instead of a haploid number.

If an egg without chromosome (o) fertilizes a normal sperm (n), the resulting zygote will have haploid number (n) of chromosome.

If an egg with diploid number of chromosome (2n) fertilizes a normal sperm (n), the resulting zygote will be a triploid with 3n number of chromosome.

8 0
4 years ago
Other questions:
  • What type of receptors embedded in the urinary bladder wall initiate the micturition reflex?
    7·1 answer
  • A student designs an electromagnet, as shown in the picture. The electromagnet is only able to pick up 1 paper clip. List 2 modi
    6·1 answer
  • In comparison with primary​ storage, hard drives are​ ________.
    12·1 answer
  • Why might it be beneficial to express genes only when they are needed?
    15·2 answers
  • Which of the following disorders is by an individual who has the habit of eating to excess and then purging by vomiting?
    12·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Does cell which has chloroplast have to have mitochondria?
    11·1 answer
  • What is the energy transformation of a flashlight?
    6·1 answer
  • Do y’all know each of these ?<br> HELP PLEASE !!!
    11·2 answers
  • How do we ensure that society appreciates the full importance of plants?​
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!