1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Reil [10]
4 years ago
15

Plz need help asap !!!

Biology
1 answer:
Alexus [3.1K]4 years ago
6 0

The cell is preparing to split. The cells are going to be equal so I'd say it's the bottom image

You might be interested in
Polymerase chain reaction (pcr) is an essential technique for the study of dna. pcr uses a dna polymerase enzyme from thermophil
Vsevolod [243]
Can it be a whole number or a fraction
8 0
4 years ago
What is true of the members of the same population? Select all that apply.
Simora [160]

Answer: B and E

Explanation:

4 0
3 years ago
Animal cells have which of the following characteristics? Select all that apply.
mixer [17]

Answer:

cleavage

Explanation:

i really don't know

4 0
3 years ago
Read 2 more answers
Which of the following statements is true?
SCORPION-xisa [38]

Answer:

D.Radiant energy does not require a medium through which to travel.

Explanation:

7 0
3 years ago
Which is not an accurate classification of the python<br>A. Invasive<br>B. Native<br>C. Introduced
lara31 [8.8K]

Answer:

B!

Explanation: hope this helps

7 0
4 years ago
Other questions:
  • 80 points and marked Brainliest for anyone who can do this whole lab sheet for me please, i would greatly greatly appreciate it!
    7·1 answer
  • Why do cells need to use transport proteins to function?
    15·1 answer
  • Acid rain is wearing away at a statue in the town square. What process is causing this?
    7·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • A gradual change in the environment takes place slowly over a long period of time.
    14·2 answers
  • Which of the following factors affecting population growth is density
    8·1 answer
  • Overgrazing reduces grass cover and negatively impacts the soil health by reducing it's ability to hold water . How can Overgraz
    11·1 answer
  • 1. Describe how energy is transferred from one organ-
    8·1 answer
  • Explain in your own words why pH and temperature can affect enzyme function
    15·1 answer
  • 1. Describe the first step in the digestive process. Why is it important?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!