How does algae reproduce? Select the best answer.

1 answer:

4 0

I believe your best answer would be the third option, both sexually and asexually. Some types of algae reproduce asexually due to the division of one cell into two or even more brand new cells that are genetically similar to the parent cell. However, other types of algae participate in sexual multi-cell reproductive cycles.
I hope this has answered your question and I do apologise if I am wrong. Good luck on your assignment :)

You might be interested in

How do beach nourishment and vegetation management differ in the ways they manage beach erosion?

kupik [55]

Answer:

Beach norishment refers to addition of sand on beach to reduce the erosion effect by water currents.

Vegetation management is the (re)plantation of plants to reduce the erosion effect on beaches caused by waves.

Explanation:

In the statements given above, addition of hard structure doesn't primarily means beach nourishment, likewise, vegetation management doesn't replace the sand on beach rather prevent sand erosion. However, vegetation management brings in plants that hold the sand especially on sand dunes. Floods cannot be totally controlled by beach nourishment but with the help of plants, their impact can be minimized.

3 0

3 years ago

Which does the salt in the ocean come from?

In-s [12.5K]

Answer:

Rocks on land

Explanation:

The salt in the ocean comes from rocks on land.

6 0

3 years ago

Read 2 more answers

Pls, I need help with this! Biology Thank you :)

topjm [15]

Answer:

If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG

If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG

Explanation:

8 0

3 years ago

Why do you think DNA replication important to the growth and development of a multicellular organism

77julia77 [94]

I think dna replication are inportant because of the cells in the dna

5 0

3 years ago

What elements are shared between the four macro molecules?

Aneli [31]

I believe it may be carbon, hydrogen and oxygen..

6 0

3 years ago