Answer should be death rate
Answer:
Two members of the excavate clade that can cause disease are <u><em>diplomonads and parabasalids</em></u>
Explanation:
The excavate clade comprises of unicellular organisms which are eukaryotic. This group contains free-living organisms as well as organisms which form symbiotic relationships.
The diplomonads can be described as a group of flagellates which are considered to be parasitic. Some of them are even parasites to the humans.
The parabasalids are a group of flagellated protists within the supergroup Excavata. These organisms also form parasitic relationships.
Answer: Option D
Explanation:
Once the pathogen enters the body, it starts dividing and after a certain period of time the patients experience some sign and symptoms of illness.
The prodromal period occurs just after the incubation period. In this phase the pathogen keeps on dividing and the host begins to experience general symptoms and signs of illness.
This is a result of the activation of immune system of the body which results in the swelling, pain, soreness.
Answer:
a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\
b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d.The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
