Answer:
Their cell walls are composed of very different biochemicals.
Explanation:
Biological classification is important to classify the organisms on the basis of their similarities and differences between them. Linnaeus is known as the father of biological classification.
Cellwall plays an important role in the maintenance of structure and function of the organisms. The composition of the cell wall of fungi, plants and prokaryotes are quite different. Plants cell wall made of cellulose, fungi has chitin in its cell wall and prokaryotes has different layers of cell wall.
Thus, the correct answer is option (D).
Answer:
D
Explanation:
During metaphase of cell division, the chromosomes line up in the metaphase plate and the spindle fibers from the poles extend and attach to the centromeres of the chromosomes. The spindle then contracts and pull different chromosomes to the opposite poles of the cell before the parent cell divides. If spindle fibers do not form, then the chromosomes will not separate during anaphase.
Therefore, the final cell after mitosis will be a cell with double the number of chromosomes -because if you remember, during interphase, genetic material is replicated so each daughter cell can have its copy-. Due to quality control in the process of cell divisison, this cell will mostly undergo apoptosis, otherwise, it could develop into cancer.
The four main stages of Interphase are Gap 0, Gap 1, S phase and Gap 2. Interphase appears to be a resting stage in cell divisions but actually many activities or processes happens at this phase. Interphase generally lasts at least 12 to 24 hours in mammalian tissue.
Answer:
A) chemical reactions.
Explanation:
"Photosynthesis is the process through which plants convert light energy into chemical energy. Here is the chemical reaction involved: As we can see, water and carbon dioxide combine to form glucose and oxygen. Since new chemical species are formed, photosynthesis is clearly a chemical change.
"
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
