Answer: adaptive immune response
Explanation:
Autoimmune disorders are caused by different microoorganism and drug which manipulates the immune system in a way that immune system become unable to recognise between self antigen and foreign antigen. In that case immune system treats foreign antigen as self antigen which cause systemic or organ specific damage.
The exact cause of autoimmune disorders is unknown and hence it is thought that it is caused by adaptive immune response which builds against self antigens and causes damage to the cells.
Hence, some autoimmune disorders are thought to be caused by adaptive immune response.
The answer is; C & E
Building a dam alters the water regime down the dam. The dam also affects fish migration along the river, alters the transportation of sediments by the river downstream, and changes temperatures within the local environment of the dam. These changes, however, the subtle effect the ecosystem around the dam and down the river. The potential energy of the water held by the dam is, however, high and used to produce more electricity.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
To copy the DNA, recombinant DNA method use bacteria such as E. Coli whose plasmids has been combined with various gene to produce the substance that is wanted.
Answer:
One change to Earth's surface can result in changes to other Earth systems.
All of the spheres on the Earth are interconnected, and they constantly interact with each other. When there's a change in one of the spheres then the other ones have changed as well. This is the case with the hydrosphere and the atmosphere. The atmosphere is becoming hotter in the past few decades, and this is contributing to the increased temperature of the hydrosphere (in this case, the sea surface). With the increasing temperatures of the sea surface, the cyclone activity becomes bigger and stronger, and this contributes to lots of natural disasters. So we can easily see the interaction and changes in this case between the spheres;
* atmosphere gets hotter - temperature of the sea surface rises - bigger cyclone activity.