1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ELEN [110]
3 years ago
7

Start with the P generation with the following genotypes (AA x aa). Based on classical Mendelian inheritance, how will a cross b

etween two homozygous parents, one dominant and one recessive, influence future generations?

Biology
2 answers:
vampirchik [111]3 years ago
6 0

Answer: The genotype of the generation resulting from the given P ( parental generation) is Aa that is all offsprings in the first generation will be heterozygous dominant.  

The genotype of the parents is AA and aa and the gametes produced by these parents are A and a respectively.

When these gametes fuse, they result in the offsprings with genotype Aa. This represents a dominant phenotype due to the presence of dominant gene  (  a gene that masks the expression of recessive gene and expresses itself), which is A in this case.

konstantin123 [22]3 years ago
5 0

Answer:

C)

Explanation:

Although the F1 generation will all show the dominant trait, the offspring will all be heterozygous and increase chances of future variation.

You might be interested in
What are body parts similar in origin and structure called
aleksandrvk [35]
That body parts are called "Homologous Organs" which are similar in origin & structure.

Hope this helps!
4 0
3 years ago
If a person cuts his finger eventually the cut will heal and the skin will be whole again how does the gap created by the cut ge
Greeley [361]

Answer:

Cells on either side of the cut pull toward each other until they close the gap.

~Hope this helps!~

8 0
3 years ago
What factors contribute to past and present changes in California's sea otter population?
ra1l [238]

Answer:

White shark bites, parasites, food availability, habitat degradation are among some of the contributing factors threatening the recovery of the species. The greatest threat to a sea otter is the oil spills.

Hope this helps!

Extra - Fun fact - Sea otters play a vital role in the health and stability of the nearshore marine ecosystem as a keystone species.

6 0
3 years ago
Read 2 more answers
Sections in the crust bend sharply to form mountains as a result of sections in the crust bend sharply to form mountains as a re
attashe74 [19]
An uplift from earths crust
8 0
3 years ago
1. The______<br> powers the process of photosynthesis. What’s the blank?
arsen [322]

Answer:

The light from the Sun powers the process of photosynthesis.

Hope it helps!

6 0
3 years ago
Read 2 more answers
Other questions:
  • PLZ HELP!!! Which statements describe the image? Check all that apply. The wood is releasing argon gas. This information is usef
    6·2 answers
  • In the early days of germ theory, contagious diseases were thought to be caused by fungi or bacteria. In the 1890s, Dmitri Ivano
    10·1 answer
  • How does water temperature affect bullfrog behavior
    6·1 answer
  • How many years does an apple tree live useful?
    6·1 answer
  • A geneticist has devised a strategy to study protein translocation into the endoplasmic reticulum (ER) in yeast cells. She is in
    14·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Which statement correctly explain these changes?
    6·1 answer
  • A clownfish protects the sea anemone from being attacked. The clownfish hides within the sea anemone for protection. This is an
    9·1 answer
  • Brown eyes in humans are dominant to blue eyes. A brown-eyed man, whose mother was blue-eyed, marries a brown-eyed woman whose f
    10·1 answer
  • 1. The Human Genome Project has demonstrated that in humans of all races and nationalities approximately 99.9 percent of the gen
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!