1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vovangra [49]
3 years ago
8

Drag each item to the correct location in order to place the events in the development of plants into the correct order​

Biology
1 answer:
tiny-mole [99]3 years ago
7 0
<h2>Events in Development of Plants</h2>

Explanation:

The events in the development of plants is as follows:

1. Cyanobacteria begin to photosynthesize.

Cyanobacteria which are commonly called as Blue green algae are Prokaryotes.

They are aquatic and photosynthetic, it means, they live in the water, and can manufacture their own food.

2. Cyanobacteria become the chloroplast of plants.

Cyanobacteria have the endosymbiotic plastid. Eukaryotes or plants considered to have evolved from endosymbiotic cyanobacteria.

3. Bryophytes become the first land plants.

Bryophytes are the first land plants to be evolved from aquatic plants, specifically green algae.

4. Plants evolve to have vascular tissue to transport water.

During the evolution of plants from Bryophytes to Pteridophytes, Pteridophytic  plants have vascular tissue i.e. xylem and phloem. Xylem helps in transport of water to various parts of the plants.

You might be interested in
How does climate affect each of these things ? give separate answer for each one .
Otrada [13]

Answer:

3

Explanation:

when the climate changes sometimes it can make drought occur

6 0
3 years ago
Read 2 more answers
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
2 years ago
Complex chemistry is most related to
mars1129 [50]
A complex chemistry is most related to maintaining a stable internal environment.
6 0
3 years ago
The two main phases of the cell cycle are the cytokinetic phase and interphase
Vitek1552 [10]

Answer:

Flase

Explanation:

The cell cycle has two major phases: interphase and the mitotic phase. During interphase, the cell grows and DNA is replicated. Usually the cell will divide after mitosis in a process called cytokinetic in which the cytoplasm is divided and two daughter cells are formed.

hope this helps

have a great day/night :)

4 0
3 years ago
Read 2 more answers
What skills and knowledge do you hope to gain from your proposed study programme?​
Dennis_Churaev [7]

Answer:

As my study programme is concerned with the field of biotechnology, I hope that by the end of the proposed study programme, I will be able to gain knowledge about the molecular tools and the concepts and trends in genome editing. I shall be able to perform techniques such as PCR, gel electrophoresis, cell culturing easily. I would be able to grasp better knowledge in the fields of plant biotechnology, animal biotechnology, Industrial biotechnology and marine biotechnology.

4 0
3 years ago
Other questions:
  • An organism's fitness can be best measured by observing its
    9·1 answer
  • What is the main idea of the story knights and dragons
    10·1 answer
  • Check all of the following which could describe the first interaction of the acquired immune system to an infection. A. Binding
    14·1 answer
  • What is the function of the cebtrosome and centioles in the cell during mitosis
    7·1 answer
  • Studying nutrition means you must also have an understanding of ____________, the study of the composition and characteristics o
    8·1 answer
  • Consider a population of snowshoe hares in Montana. Their fur color changes in response to changes in day length. During the lon
    6·1 answer
  • T or F: Natural Resources are man made
    12·2 answers
  • What percentage of the offspring are going to be golden ?​
    8·2 answers
  • Which of the following could be use to tell the difference between a living thing in the domain bacteria and one in the domain e
    6·1 answer
  • PLEASE HELP ME (NO LINKS)
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!