1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kow [346]
3 years ago
6

How does photosynthesis follow the laws of conservation of mass.

Biology
1 answer:
Elena-2011 [213]3 years ago
8 0
I feel like it's four because of the eco left on
You might be interested in
Warm-Up
frozen [14]
Cell wall

Chloroplasts

Everything else, I believe, are in both animal and plant cells.

I hope this helps!

5 0
3 years ago
In a eukaryotic cell, DNA is found in_______?
IrinaVladis [17]
In a eukaryotic cell, DNA is found in found<span> in the nucleus</span>
7 0
3 years ago
Read 2 more answers
Where is atp synthase located in the mitochondrion
Mice21 [21]

the ATP synthase complex is located in the inner membrane of mitochondria, with the ATP synthesis reaction occurring on the membrane side toward matrix compartment

3 0
3 years ago
A student is performing experiments on a particular substance. Which
koban [17]

Answer:

of what substance??

Explanation:

4 0
3 years ago
Read 2 more answers
Which statement is true about stromatolites?
Neko [114]

they are layered mounds of deposits made by precambrian algae

5 0
3 years ago
Read 2 more answers
Other questions:
  • Which symbol on a regulatory marker indicates hazards such as rocks or stumps? green square?
    12·1 answer
  • Which two of these characteristics are examples of endoskeletons?
    12·2 answers
  • If the top metal plate is negatively charged, what is the charge of the droplets that will be attracted to it?
    15·1 answer
  • The _____ system consists of all of the nerves and cells throughout the body whose job it is to receive and transmit information
    13·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Pros and cons of hela cells ?
    9·2 answers
  • What is true about warm, saturated air
    7·1 answer
  • which of the following changes would most likely lead to a mammal population exceeding its carrying capacity
    7·1 answer
  • Find the area of the following triangle:
    5·1 answer
  • Is the trend in biomass in Pyramid X the same as seen in Pyramid Y? Explain your answer.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!