1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Juli2301 [7.4K]
3 years ago
12

What are two advantages of setting up instruments for measuring carbon dioxide on top of mauna loa​

Biology
1 answer:
kari74 [83]3 years ago
4 0

So it's easier to understand how plants take in carbon-dioxide and how much carbon-dioxide is in the atmosphere

You might be interested in
Can anyone plz help me on this question
Harrizon [31]

Answer:

1. puppy 3

2.d.fur pattern

3.g.mother

7 0
3 years ago
Do plants absorb nitrogen?​
vladimir1956 [14]

Answer:

No, not absorb nitrogen.

6 0
3 years ago
Read 2 more answers
Animals eat plants and convert the chemical energy contained in them into
AlekseyPX

Answer:

food molecules into thermal and kinetic energy

Explanation:

The energy held in food is called chemical energy. It is a form

of potential energy held within chemical bonds between

atoms. When the chemical energy in food is transferred to cells

in the body, the energy can be transformed into energy used by

the body to do many things like run, ride a bike, do the dishes,

pump the heart, and keep the body warm.

6 0
3 years ago
Which is a correct statement about rna molecules?
Sergio039 [100]
RNA contains the genetic blueprint molecules for making protien
4 0
3 years ago
Read 2 more answers
How has the study of mitosis affected scientists’ knowledge of cancer?
34kurt

Answer:

Through studying the process of mitosis, the scientists gained knowledge of cancer. The study led into a wider understanding of cancer because it led to an apprehension on how cancer cells divide and split into two so rapidly. 

Explanation:

Hope this helps!!

4 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • These question all about ice storms!!!!!!!! answer them in complete sentence
    6·2 answers
  • HELP! 10 POINTS! EASY BRAINLIEST<br> What are the main types of dwarf boas?
    8·2 answers
  • Were are antibodies found
    15·1 answer
  • A good model of the cell membrane would be
    7·1 answer
  • According to the principle of _______, a change in one species in a community results in a change in another.
    6·2 answers
  • Which is another name for observations?
    6·1 answer
  • Help ASAP please fast I need help
    10·1 answer
  • Anyone there from kvs school bihar <br>i need help​
    13·2 answers
  • What is the difference between animal and plant cells?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!