1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Arada [10]
3 years ago
7

The most famous case involving ___________________ is ProCD Inc. v. Zeidenberg (1996). ProCD sold a software product that was a

searchable telephone directory database. ProCD sued Zeidenberg based on the argument that Zeidenberg breached the terms of the license agreement that was included in the ProCD software box.
Law
1 answer:
mojhsa [17]3 years ago
7 0

Answer:

shrinkwrap contracts

Explanation:

You might be interested in
Help ASAP law thanks !
Setler [38]
C is the correct answer
5 0
2 years ago
1. The _____ asks a court to be appointed in order to collect assets. (1 point)
OlgaM077 [116]
1. Is administrator

2 a power of attorney

3. I THINK it is his or her spouse

4 if all beneficiaries consent to the trusts termination

5 holographic will

6 health care proxy

7 testamentary trust

8 intestate

9 trustee

10 beneficiaries
7 0
3 years ago
10 points each<br>is wearing a mask a law now?
aleksley [76]
Yes it had been for a while but people choose not to wear them even though there is a pandemic.
3 0
3 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
2 years ago
If a nurse thought her mother had the flu and brought home antiviral antibiotic samples from work what principle of ethic was vi
svlad2 [7]
As she is not fully qualified to do that as it hasn't been property diagnosed and recorded
5 0
3 years ago
Other questions:
  • How old was president G.H.W. Bush when he was first inaugurated
    13·2 answers
  • A system of government in which power is divided between the federal government and the many individual state governments
    9·1 answer
  • Read this passage from the Articles of Confederation:
    5·1 answer
  • Question 7
    15·2 answers
  • Ethics refers to the understanding of what constitutes good or bad behavior and help to guide our behaviors.
    15·1 answer
  • Nicki Minaj (50% full power) vs Scarlet Witch who wins
    9·1 answer
  • URGENT 40 POINTS
    6·2 answers
  • Does OSHA provide employees with insurance?
    14·1 answer
  • What does a single solid white line mean?
    12·2 answers
  • Explain how Americans' commitment to<br> freedom led to the creation of the Bill of Rights.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!