1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zvonat [6]
3 years ago
7

In late adulthood, Mr. Klondike has become increasingly likely to make a socially impolite remarks about other people's appearan

ce or mannerisms. His blunt comments are most likely to indicate late life atrophy of the _____ lobes.
Biology
1 answer:
xz_007 [3.2K]3 years ago
6 0

Answer:

frontal

Explanation:

  • In a mammalian brain, there are four major lobes that are present and one of them is the frontal lobe.
  • The frontal lobe is mainly rich in dopaminergic neurons and thus, it is mainly concerned with functions such as memory, reward, motivation, planning, attention, etc.
  • The process of break down of tissues and cell death in the tissues is referred to as atrophy and since the frontal lobe is associated with the functions as mentioned above its atrophy would lead to a slow decline in these functions.
  • Since Mr. Klondlike behavior is changing his blunt comments are most likely a result of atrophy of the frontal lobe.
You might be interested in
hich statement about warming up before playing sports is NOT true? A. It is necessary to continue to stretch during the game. B.
Jobisdone [24]

"D is correct answer." The statements are true it's necessary to continued to stretch from during the game. Getting the blood moving through your muscles prepares them for physical activity. Joints can be warmed up through stretching. "Hope this helps!" "Have a great day!" "Thank you for posting your questions!"

5 0
4 years ago
Read 2 more answers
Identify the function of two endocrine glands.
brilliants [131]

Pituitary gland: Responsible for growth and reproduction, it secretes and stores hormones and influences how other glands act.

Adrenal gland: It’s responsible for producing certain steroid hormones, including aldosterone and cortisol.

It's a vague description of the two.

6 0
3 years ago
Which of the following would be true when comparing plants in the desert and rainforest?
katrin2010 [14]

Answer:

B. Plants in the desert would have a decreased number of stomata compared to rainforest plants.

8 0
3 years ago
A population of crabs live on a light-colored sandy beach. In this environment there is a population of birds that eat the crabs
Pachacha [2.7K]
Yes yes the answer is b ok ok
4 0
3 years ago
Read 2 more answers
Which of the following is not actual whole cell?
DochEvi [55]

Answer:

C. Thrombocytes

Explanation:

Blood is a tissue composed of many cells, which include; red blood cells (erythrocytes), white blood cell (leukocytes), platelets (thrombocytes) etc. Of these three types of cells, thrombocytes also known as Platelets are small fragments of a cell with a disk-shape whose primary function is in blood clotting.

In contrast to erythrocytes, and leukocytes (monocytes, lymphocytes) as mentioned in the question, thrombocytes or platelets are not actual whole cells but rather small portion of a cell.

6 0
3 years ago
Other questions:
  • When two plates collide it is at this type of boundary.
    8·1 answer
  • How are lysomes and vaculoes the same?How are they different?
    10·1 answer
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • What is common about all eggs no matter their size, grade, or color?
    10·1 answer
  • What connection does an ant have with an elephant
    5·1 answer
  • Vegetation that grows along the floors of tropical and temperate forests is called undergrowth. How is the undergrowth of a trop
    7·2 answers
  • Animal behavior Essay
    9·1 answer
  • Monomers are made up of many polymer units. True or False
    12·1 answer
  • 2)Through the action of osteoclasts,
    7·1 answer
  • Which of the following statements is TRUE about geographic isolation?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!