Ok I think its small polar molecules but I could be wrong.
A marine biologist is examining the effects of oil pollution on a population of birds known as seagulls (Larus canus). She is particularly concerned that oil pollution may reduce the number of eggs raised in a seagull nest. During one breeding season, she counted the number of eggs present in a sampling of six seagull nests near each of the 14 refineries throughout the state. She discovered that seagulls laid and raised an average of four eggs per season. To confirm her hypothesis, the researcher must now examine seagull nests that have not been exposed to oil pollution. The researcher believes she is correct, and so expects to find D) 4-6 eggs per nest.
Answer:
Carbohydrate and mitochondria are closely connected with each because carbohydrate is a food substance from which energy is extracted by the mitochondria of the cell. Mitochondria is called the power house of the cell. Its main function is to make energy for the cell which used this energy to perform various function by using food material such as carbohydrate. So we can say that both are connected with each other.
The correct answer is going to be <span>C. It is the continuous movement of water under, on or above the Earth's surface</span>
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
