Answer:
Option (d).
Explanation:
Equilibrium may be defined as the state of the equality on both the sides of the reaction. Different types of equilibrium are physical equilibrium, chemical equilibrium and dynamic equilibrium.
Chemical equilibrium may be defined as the equilibrium in which the reactants and products concentration remains constant with time. The rate of the backward reaction is equal to the rate of forward reaction.
Thus, the correct answer is option (d).
<span>He is at an increased risk for sudden infant death. Since he is sleeping on a mattress that might inhibit his breathing, as well as having respiratory issues that might do the same (along with parents who are smoking, which will only inhibit proper respiration further), he will need to be constantly checked to make sure he is sleeping properly.</span>
False.
Basal Metabolic Rate is the term used for when at rest.
I believe that it is the old growth not sure which one but between B and D I would go with B but I am not sure (hope I helped in some way )
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
