1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andriy [413]
2 years ago
6

A specialty area that focuses on the connections between brain activity and mental processes is known as

Biology
1 answer:
Dmitry [639]2 years ago
7 0
Its known as the cognitive neuroscience
You might be interested in
An AAbb strain is crossed to an aaBB strain and the resulting progeny self-crossed. If A andB are located 10 cM apart from each
skelet666 [1.2K]

Answer:

20.3%

Explanation:

Given that:

An AAbb strain is crossed to an aaBB strain

i.e.

                   AAbb      ×      aaBB

gametes       Ab                   aB

For F₁

generation;  

If the resulting progeny are now self-crossed.

We know that the genetic distance between these two genes on the same chromosome is said to be 10 cM.

i.e. the recombinant gene = 10%; Hence, the parental gene will be (100 - 10)% = 90%

Ab ×   aB  =   Aa    AB      ab     Bb

From above; the parental gene;

Ab and   aB = 90% with each being 45%

i.e. Ab = 45%   and aB = 45%

while the recombinants genes are:

AB and ab = 10%

i.e. AB = 5%  and ab = 5%

Finally; the percentage of aaBB is = aB% ×  aB% × 100%

the percentage of aaBB is = 0.45 × 0.45 × 100%

the percentage of aaBB is = 20.25%  ≅ 20.3%

8 0
2 years ago
Antibiotics fight infections by
aleksandr82 [10.1K]

Answer:

preventing viruses from replicating

Explanation:

6 0
2 years ago
compare the thickness of the wall of the superior and inferior vena cava and the aorta. which is thicker and why???
mariarad [96]

Answer:The wall of the aorta is thicker than that of the inferior venacava; this is because the aorta is the artery that carries blood from the heart from the left ventricle to the whole body (except the lungs), while the superior and inferior venacava are the veins that carry blood from the body to the right atrium. hope this helps !:)

Explanation:

8 0
3 years ago
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
Which of the following is the quality of a good scientific hypothesis?
CaHeK987 [17]

Answer:

The correct answer is - option a. It should be testable in a valid period of time

Explanation:

A thought that presents a temporary clarification about a phenomenon observed by a scientist is a hypothesis. The fundamental highlights of a good scientific hypothesis are: testability and falsifiability  

A testable scientific hypothesis should answer the logical question. This is one that can be checked valid or bogus utilizing the information gathered or the experience gained.  

a good scientific hypothesis must be testable and falsifiable. We should have the option to test the hypothesis utilizing the techniques for science and in the event that you'll review Popper's falsifiability rule, it must be conceivable to accumulate proof that will disconfirm the theory on the off chance that it is surely false.

Thus, the correct answer is - option a. It should be testable in a valid period of time

7 0
2 years ago
Other questions:
  • Which organelles are found only in plant cells?
    14·2 answers
  • If your job requires you to use a respirator, your employer is required to do three things. What is missing from the list?
    13·1 answer
  • At age 4, James underwent a biopsy of the right gastrocnemius muscle. The pathologist's report noted histopathologic changes sug
    12·1 answer
  • Which of the following is the most likely global climate change? a. a decrease in the overall temperature of the Earth b. an inc
    15·2 answers
  • Where in an equation for photosynthesis does carbon dioxide belong
    12·1 answer
  • To which region of the stomach does the esophagus connect?
    11·1 answer
  • Which is a group of tissues that work together to carry out a common function?
    10·2 answers
  • What happens to an enzymes structure as it exceeds the typical human bady temperature
    7·1 answer
  • Mutations that hinder the survival of an organism
    14·1 answer
  • What does it feel like when you're lonely? I'm asking you, please answer in your own words, this is for an experiment.
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!