1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nekit [7.7K]
4 years ago
9

Question 1 (5 points)

Health
2 answers:
Tamiku [17]4 years ago
6 0
I hope u have a great day pls help you get it to you do it for a few minutes to see what you can get it here and you have a great time to do that and i and i told her that you were in north and i was in heaven with you
kap26 [50]4 years ago
5 0
20 questions for 5 points...? You do it.
You might be interested in
In the central nervous system is contained within these cavities except which one?
timurjin [86]

Answer:

D. Abdominal cavity

Explanation:

The abdominal cavity includes most organs from the digestive system, e.g. stomach, intestines, liver, appendix, rectum, and more. Thus, it's not apart of the central nervous system.

Have a lovely rest of your day/night, and good luck with your assignments! ♡

4 0
2 years ago
True or false, guns are difficult to obtain by abiding- citizens
lisabon 2012 [21]
False, background checks are mandatory to obtain a gun. but if your record says that you've had a federal offence before then no you will not be allowed to obtain a firearm
5 0
4 years ago
An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​
s2008m [1.1K]

Answer:

With an eye toward understanding DNA replication, Cornell researchers have learned how a helicase enzyme works to actually unzip the two strands of DNA. The results are published in the journal Nature. At the heart of many metabolic processes, including DNA replication, are enzymes called helicases.

Hope it helps?

Explanation:

5 0
3 years ago
FREE BRAINLEIAST FOR FIRST TO ANSWER GOGOGOGO!!!!
Rudiy27

Answer:

have a good day

Explanation:

5 0
3 years ago
The bar chart identifies the percentage of adults who are familiar with a range of eating disorders.
Len [333]
Wouldn’t the answer be 43%
8 0
4 years ago
Read 2 more answers
Other questions:
  • For adolescents, risk of drug abuse increases greatly during times of ________.
    12·2 answers
  • A patient presents to the emergency department (ed) with a sucking chest wound. the ed physician on duty performs an immediate t
    7·1 answer
  • Which of the following statements is TRUE?
    8·1 answer
  • How does urine move from the kidneys to the urinary bladder?
    7·1 answer
  • Match each source of health information to its level of trustworthiness.
    13·2 answers
  • what can childhood education centers do to reduce the chances of child maltreatment happening on their premises
    5·1 answer
  • Female sex cells are also called _______. A. Graafian follicles B. ova C. fallopian D. fimbria
    5·2 answers
  • Which of these professionals specializes in diagnosis, treatment, and prevention of mental illnesses and can prescribe medicine?
    11·2 answers
  • Can somebody help me?
    13·1 answer
  • Current research suggests that most eating disorders are caused by
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!