1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AlexFokin [52]
3 years ago
10

Which job must enzymes do before replication can begin?

Biology
1 answer:
Scorpion4ik [409]3 years ago
4 0

Answer:

Before they replicate the two DNA strands need to separate from each other.

Explanation:

You might be interested in
Chromosomes are...
gtnhenbr [62]
A. DNA material coiled up in a pile.
3 0
2 years ago
NEED HELP!!!!!! QUICK PLEASE!
Sliva [168]

Answer:

Last one

Explanation:

I took this test

8 0
3 years ago
Read 2 more answers
What is the difference between an independent variable and a dependent variable? How are these different from constants?
german
The variables in a study of a cause-and-effect relationship are called the independent and dependent variables. The independent variable is the cause. Its value is independent of other variables in your study. The dependent variable is the effect.
5 0
3 years ago
Select the correct answer. Which word root describes the penis in medical terminology?
ella [17]

Answer:

B

Explanation:

Phall, as the Latin term for the penis is <em>Phallus. </em>The others are related to parts of the genital or to stuff related to it.

4 0
3 years ago
Read 2 more answers
True or faults biologist classify specific forms of trades as good or bad
Katarina [22]
False biology is about learning the anatomy of plants and humans
3 0
3 years ago
Other questions:
  • What are the 2 hormones that are released from the anterior pituitary that influence both the female and male reproductive syste
    5·1 answer
  • A company develops a new antibiotic. When the antibiotic is first used, it kills nearly all the bacteria.
    8·1 answer
  • Is the following sentence true or false?? Fermentation releases more energy than respiration.
    11·1 answer
  • How can a map of the seafloor be generated using mechanical waves?<br> Please Help!!!
    7·1 answer
  • True or false the physical aspects of a habitat are called the biotic factors
    7·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • In scientific times people classified plants and animals by use.<br> True or false
    8·2 answers
  • Why are organisms that reproduce sexually less likely to accumulate deleterious mutations ?
    9·1 answer
  • Which organisms were the least numerous? Why? (In a forest environment!)
    13·2 answers
  • Please look in comments because question is not posting
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!