1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Thepotemich [5.8K]
3 years ago
5

Select all the correct answers.

Biology
1 answer:
Ghella [55]3 years ago
6 0

Answer:

The correct answers are:

A) It created a need for additional natural resources to be used in manufacturing;

D) It created the need to find new markets to sell European goods;

The Industrial Revolution brought in new technologies in the manufacturing processes, and everything was done much easier and quicker, with the same or even better quality. As the industry was growing, in order to continue with the growth, it needed more natural resources, but also new markets for selling the goods and make bigger profit. In order for both of these goals to be achieved so that the industry continues to strengthen, the industrial countries started colonizing new countries, on multiple continents, where they managed to find the natural resources they needed, and also the required market for sale.

Read more on Brainly.com - brainly.com/question/3067894#readmore

Explanation:

You might be interested in
What is the energy brought by electron carriers to the<br> mitochondria used for?
Nonamiya [84]

Answer:

The correct answer will be- to synthesise the ATP molecules in respiration process.

Explanation:

The electron transport chain is the last phase of the cellular respiration which helps in the synthesis of a large number of ATP molecules.

The ATP molecules are synthesized when the energy generated by the movement of protons through CF₀ unit takes place.

The movement of electrons in the chain leads to the movement of proton from the mitochondrial matrix to the intermembrane space. This creates the proton gradient across the membrane which to equilibrate the protons move down the concentration gradient through ATP synthase. The energy while this is used to rotate the ATP synthase which coverts the ADP to ATP.

Thus, to synthesise the ATP molecules in the respiration process.

3 0
3 years ago
What amino chain is coded for by the mRNA sequence 5'AUGUGGAUUUU3'?​
Radda [10]
is this coding app making or no
8 0
2 years ago
Members of the phylum Actinobacteria have had a profound impact on human health over the course of civilization. One member of t
Drupady [299]

Answer:

The correct answer would be - mycobacterium, and streptomyces.

Explanation:

Actinobacteria is a phylum that consists of a group of gram-positive bacteria with cytosine and guanine content in their DNA. These bacteria can be aquatic or land bacteria. Actinobacteria do not have cell wall however they make a non-sptate and mycelium.

Mycobacterium is one of the genera of the actinobacterium phylum. This genus includes pathogenic species in it that cause deadly diseases in humans and other mammals such as leprosy and tuberculosis Whereas streptomyces is another genus of the actinobacteria that is yielded the very first drug to fight with the ancient scourge.

Thus, the correct answer is - mycobacterium and streptomyces.

8 0
3 years ago
PLS HELP!!!
Leviafan [203]

Answer:

C. Loess does not erode easily

Hope this helped

Explanation:

5 0
3 years ago
Read 2 more answers
in the dna in chromatin, substitution mutations: a. are at a maximum in the nucleosomes b. are rarely seen, but deletion mutatio
Gelneren [198K]

In chromatin, substitution mutations are most common in linker regions. Option d is the correct answer.

Mutation by substitution When one nucleotide base is replaced by another, this occurs. Mismatch mutation A type of substitution mutation in which a single nucleotide is replaced, resulting in the coding of an incorrect amino acid, which usually results in a malfunctioning protein. Silent mutations are the result of genetic code redundancy (degeneracy): This is false, as silent mutations are the result of a base substitution that has no discernible effect on a protein's amino acid sequence.

Learn motre more about subsitution here:

brainly.com/question/29383142

#SPJ4

7 0
1 year ago
Other questions:
  • Reproductive isolation is not an accurate term to describe populations of a species that
    15·1 answer
  • Butterflies show r-selection traits. What does this statement imply?
    14·2 answers
  • How can mutations impact genetic variation??
    8·1 answer
  • Please help me with my biology homework !
    13·1 answer
  • 1. DNA strand 1: TCT- TTA- CAT<br> - DNA STRAND 2: <br> - mRNA: <br> amino acid sequence:<br> tRNA:
    14·2 answers
  • When warm air exists above cold air, thereby trapping the cold air, this is referred to as a __________
    11·2 answers
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Which type of wave forms at the boundary between air and water in the open
    11·1 answer
  • What advantages does the five-kingdom classification have over the two-kingdom classification?<br>​
    8·1 answer
  • Why is daily muscle strengthening activity not recommended?.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!