1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kipiarov [429]
3 years ago
5

Blood levels of the readily available fuel, glucose, are tightly regulated by two chemical messengers. One of these, called insu

lin, decreases blood glucose. The other chemical messenger, called glucagon, increases blood glucose. Both chemical messengers are present at varying levels in the blood at all times. From the choices below, select all of the events that you think will happen in response to a decrease in blood glucose. a. Insulin levels increase b. Insulin levels decrease c. Glucagon levels increase d. Glucagon levels decrease e. Blood glucose levels begin to increase f. Blood glucose levels continue to decrease g. Blood glucose levels remain unchanged
Biology
1 answer:
pishuonlain [190]3 years ago
8 0

Glucagon levels increase, Blood glucose legrls begin to increase.

Glucagon converts Glycogen stored in the liver back to Glucose to be used by the body as energy.

You might be interested in
How does biodiversity vary with altitude and latitude​
krok68 [10]

Answer:

Explanation:

Biodiversity varies with a change in altitude or latitude. The diversity increases as we move from high to low altitudes (i.e., from poles to equator). ... There is a decrease in species diversity from lower to higher altitudes on a mountain.

4 0
3 years ago
What happens when a thirsty person drinks something sweet to try to quench their<br> thirst?
Nata [24]

Answer:

They become thirstier.  

Explanation:

Speaking of drinking, you should really be drinking water right now so you don't get unhydrated.

7 0
3 years ago
What substances produce carbon dioxide and water and sunlight​
jek_recluse [69]

Answer:

i think glucose and oxygen

Explanation:

7 0
3 years ago
Which process is a "build up" process? ______________________________________ which process is a "break down" process? _________
RSB [31]
Which process is a "build up" process? ___anabolism___

which process is a "break down" process? ___catabolism___

photosynthesis occurs in __the chloroplasts__

cellular respiration occurs in __the mitochondria__
7 0
3 years ago
Contaminated water called leachate from _____ can pollute groundwater.
bonufazy [111]

Answer:

option D

Explanation:

8 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • The total variety of organisms in the biosphere is called
    7·1 answer
  • __is the five-carbon sugar found in DNA
    5·2 answers
  • To prevent the disease scientists would most likely recommend that
    7·1 answer
  • What is the purpose of the enclosed seeds in a fruit found on a flowering plant?
    10·1 answer
  • Describe the significance of the secondary and tertiary structures of a protein
    10·1 answer
  • Economic importance of scorpion​
    10·1 answer
  • ТАПСЫРМАНЫҢ
    7·1 answer
  • Essay Question: Which two species are more closely related?
    6·1 answer
  • Exposure to _________ would most likely result in immediate respiratory distress.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!