1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Cloud [144]
3 years ago
5

The perimeter of triangle ABC is 82 inches. The triangle is rotated about a line that passes through points B and D.

Mathematics
2 answers:
Musya8 [376]3 years ago
7 0

Answer:

A cone with base radius of 17 in

Step-by-step explanation:

Given

Triangle ABC

Where

AB = BC = 24in

D = Midpoint of AC

Required

Which best describes the resulting three-dimensional figure?

First, the length of the third side of the triangle has to be calculated

The sides of triangle ABC are AB, AC and BC

Given that the perimeter = 82 in

AB + AC + BC = 82

Recall that AB = BC = 24in; The equation becomes

24 + AC + 24 = 82

Collect like terms

AC = 82 - 24 - 24\\AC = 34

Given that, the triangle is rotated at D, the midpoint of AC

The length of the midpoint has to be calculated

D = \frac{1}{2}AC

D = \frac{1}{2} * 34

D = \frac{34}{2}

D = 17

At this point, we can dismiss options C and D.

This is because; a triangular pyramid is formed by more than 1 triangles (at least 3 triangle) and in this case, we're dealing with only 1 triangle.

So, we have option A and B to select from.

When the triangle is rotated at point D, it generates a cone such that the radius of the cone is the distance at point D.

This implies that, a cone with base radius D is generated.

Recall that D = 17.

Hence, <em>A cone with base radius of 17 in</em>

garri49 [273]3 years ago
4 0

Answer:

A

Step-by-step explanation:

You might be interested in
Select the equation of the line in slope-intercept form: 4x – 9y = –36 07_15_UT_6d.gif 9y = 4x + 36 9y = –4x – 36 07_15_UT_6c.gi
Law Incorporation [45]
<span>4x – 9y = –36
-9y=-4x-36
take minus out
9y=4x+36
y=1/9(4x+36)
y=4/9x+4.............answer
y=mx+c is slope intercept form

</span>
5 0
3 years ago
Read 2 more answers
What is the difference between a right, acute, and obtuse triangle?
kakasveta [241]

A right triangle has one angle that's 90° and a corner that looks like an L. Obtuse triangles have one angle that's greater than 90°. In acute triangles, all the angles are less than 90°.

Step-by-step explanation:

7 0
3 years ago
Read 2 more answers
B.<br> f(x) = -1x - 4; Find f(-3)
Margaret [11]

Answer:

f(-3) = -1

General Formulas and Concepts:

<u>Pre-Algebra</u>

Order of Operations: BPEMDAS

  1. Brackets
  2. Parenthesis
  3. Exponents
  4. Multiplication
  5. Division
  6. Addition
  7. Subtraction
  • Left to Right<u> </u>

<u>Algebra I</u>

  • Functions
  • Function Notation

Step-by-step explanation:

<u>Step 1: Define</u>

<em>Identify</em>

f(x) = -1x - 4

<u>Step 2: Evaluate</u>

  1. Substitute in <em>x</em> [Function f(x)]:                                                                          f(-3) = -1(-3) - 4
  2. Multiply:                                                                                                             f(-3) = 3 - 4
  3. Subtract:                                                                                                            f(-3) = -1
4 0
2 years ago
-3x-6y=11. 2x+y = 4 solving linear systems using multiplication and addition show your work
sladkih [1.3K]
<span>Example<span>Problem<span><span>Use elimination to solve the system.</span>   x –<span> y = </span>−6x <span>+ y = 8</span></span> </span><span> Add the equations.</span><span> <span><span>2x = 2</span>x = 1</span><span>Solve for x.</span></span><span> <span>x<span> + y = 8</span><span>1 + y = 8</span>y = 8 – 1y = 7</span><span>Substitute x = 1 into one of the original equations and solve for y.</span></span><span> <span>x<span> – y = −6</span>1 – 7 = −6−6 = −6 TRUE</span><span>x<span> + y = 8</span>1 + 7 = 88 = 8TRUE</span><span>Be sure to check your answer in both equations!</span></span><span>AnswerThe solution is (1, 7). </span></span>
3 0
2 years ago
Mathematical x4 - x2 ≥ 2x
kondaur [170]
X4-x2≥ 2x~~~2x≥ 2x True Because " _ " is the same thing with "=" ; and because 2x=2x then 2x≥ 2x ~~~~~~Have a nice day!!! ★★
4 0
3 years ago
Other questions:
  • The manager of a summer camp has 14 baseballs and 23 tennis balls. The manager buys some boxes of tennis balls with 16 tennis ba
    10·2 answers
  • Is f(x)=x^2-2x+3 a quadratic function
    8·2 answers
  • An acute angle θ is in a right triangle with sin θ = seven eighths. What is the value of cot θ?
    9·1 answer
  • You are the manager of a restaurant for a​ fast-food franchise. Last​ month, the mean waiting time at the​ drive-through window
    5·1 answer
  • Gary wrapped a cube shaped gift box with wrapping paper.The box was 8 inches long.What was the minimum amount of paper Gary coul
    10·2 answers
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • What is “x” and “z” on this question?
    15·1 answer
  • Dora purchases a kitchen mixer for £425
    9·1 answer
  • Please l have a test only 5 minutes left Help
    14·1 answer
  • A CD player that regularly sells for $79.00, but is on sale for $67.15. What percent off is the sale price?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!