1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lilit [14]
3 years ago
13

Where are chloroplasts mostly found?

Biology
1 answer:
nexus9112 [7]3 years ago
6 0
Chloroplasts are most commonly found in the green (mesophyll) cells of photosynthesizing plants. Any part of a plant that is green is capable of photosynthesis and therefore contains cells containing chloroplasts.
You might be interested in
Which of the following is NOT a tissue type? *
DochEvi [55]
Answer d
Explanation
5 0
2 years ago
Why would a mutation in a somatic cell of a multicellular organism escape detection?
Mashcka [7]

When a somatic cell is mutated, none of the other cells in the organism mutate with it. Screenings usually detect mutations that are in numerous cells and not in just one. That is why a mutation in a somatic cell of a multicellular organism escape detection.

<h3>What are mutations?</h3>

A mutation in biology is an adjustment to the nucleic acid sequence of an organism's, virus's, or extrachromosomal DNA. DNA or RNA can be found in the viral genome. Errors in DNA replication, viral replication, mitosis, meiosis, or other types of DNA damage (such as pyrimidine dimers from exposure to ultraviolet radiation) can result in mutations.

These errors can then lead to error-prone repairs, particularly microhomology-mediated end joining, error-causing repairs, or errors during replication. Due to mobile genetic elements, mutations can also result from the insertion or deletion of DNA segment.

To learn more about mutations with the help of given link:

brainly.com/question/17031191

#SPJ4

5 0
1 year ago
Please help BRAINIEST :)))thank uuu
murzikaleks [220]

Answer:

the answer is d

Explanation:

5 0
3 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
What do we call an expert on microorganisms?​
Arisa [49]

Answer:

microbiologist

Explanation:

7 0
2 years ago
Read 2 more answers
Other questions:
  • Lori made a spreadsheet to track her weekly exercise. columns b-h are monday-sunday, row 2 is cardio, and row 3 is strength trai
    6·2 answers
  • Arrange these objects below from the one that allows the most light to pass through it (on top) to the object that allows the le
    8·1 answer
  • Which organism is acid tolerant and lack most internal organelles
    9·1 answer
  • Explain how a dog meets all of the characteristics of life. You may conduct your own online research using credible websites to
    13·2 answers
  • The ________ is the first relay station for gustatory information arising from the tongue.
    14·2 answers
  • Please help !!What role might an antibiotic factor such as temperature play in the evolution of a species ?
    12·1 answer
  • Which of the following best describes the relationship between a mutation and a resulting change in the eye color of a rabbit
    5·2 answers
  • Which of the following groups of organisms in an ecosystem by the amount of energy resource provides
    7·1 answer
  • Does sodium chloride retain any of the characteristic properties of either sodium or chlorine?
    14·1 answer
  • If a scientist is conducting an experiment about obesity and asks a group of people to stop eating saturated fat, that group of
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!