When a somatic cell is mutated, none of the other cells in the organism mutate with it. Screenings usually detect mutations that are in numerous cells and not in just one. That is why a mutation in a somatic cell of a multicellular organism escape detection.
<h3>What are mutations?</h3>
A mutation in biology is an adjustment to the nucleic acid sequence of an organism's, virus's, or extrachromosomal DNA. DNA or RNA can be found in the viral genome. Errors in DNA replication, viral replication, mitosis, meiosis, or other types of DNA damage (such as pyrimidine dimers from exposure to ultraviolet radiation) can result in mutations.
These errors can then lead to error-prone repairs, particularly microhomology-mediated end joining, error-causing repairs, or errors during replication. Due to mobile genetic elements, mutations can also result from the insertion or deletion of DNA segment.
To learn more about mutations with the help of given link:
brainly.com/question/17031191
#SPJ4
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.