1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LenaWriter [7]
3 years ago
8

The ___ ___ is responsible for maintaining homeostasis within any cell.

Biology
2 answers:
dmitriy555 [2]3 years ago
8 0
Cell membrane is responsible 
Brilliant_brown [7]3 years ago
7 0
The cell membrane is the on basicly in charge
You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Some archaea (single cell organisms) live in extremely salty water such as the Great Salt Lake or the Dead Sea. Most types of ce
kaheart [24]
Halophiles are extremophiles that thrive in environments with very high concentrations of salt. <span>Halophiles prevent this loss of water by increasing the internal osmolarity of the cell by accumulating </span>osmoprotectants<span> or by the selective uptake of potassium ions. Hope this helps.</span>
<span />
8 0
3 years ago
Read 2 more answers
Which group of fish do scientists believe amphibians evolved from?
Alex73 [517]

Answer:Amphibians evolved during the middle of the Devonian period (416 to 359 million years ago) from the lobe-finned fish of the vertebrate class Sarcopterygii. Species within the genus Ichthyostega (members of the Labyrinthodontia subclass) are considered by some scientists to be the earliest amphibians.

Explanation:

4 0
3 years ago
Some peeled pieces of apple were placed in distilled water and some in very salty water. The cells in the apple pieces will
QveST [7]
I think that they will g<span>ain water in the distilled water and lose water in salty water. I think water will be lost because salt is used as an drying agent, it is why when it snow they will put salt on ice to keep the ice from being slippery because it dries things up. Distill just means to purify something.</span>
7 0
3 years ago
The relationship between the bacterium Xenorhabdus nematophila and its nematode host, Steinernema carpocapsae, is classified as
Cloud [144]

Answer:

The correct answer will be-cooperate

Explanation:

Nematodes or ringworms interact with the bacteria in one of three ways: mutualism, parasitism and symbiosis.

The interaction between nematode <em>Steinernema carpocapsae</em> and bacteria  <em>Xenorhabdus nematophila</em> prove to be a symbiotic relationship as both the organisms benefit each other.

The interaction between these two organisms is also known as cooperation because both the species can live without each other also. It is during the infective juvenile stage, the bacteria start living in the intestine of the nematode and benefiting the nematode. Both bacteria and nematode help each other killing the host and then utilizing the cadaver of the host.

Thus, cooperate is the correct answer.

6 0
3 years ago
Other questions:
  • Which is the stronger force behind plate movement?
    8·1 answer
  • Which successional stage lasts longest? (Ecological succession)
    8·2 answers
  • Which of the following show how mining for materials used in smart devices impacts the environment select three
    7·2 answers
  • How do cellular junctions and receptors help an organism maintain homeostasis
    5·1 answer
  • A woman treated her home with a pesticide that kills spiders. The first application killed 78% of the spiders. Two months later
    5·1 answer
  • When ice and snow move overland in compacted large quantities, they erode the soil and can change landforms. Which object create
    9·1 answer
  • What evidence would support a scientist's claim that a certain gene is responsible for holding the instructions to produce a spe
    5·1 answer
  • What is the atomic number? What does it tell us about an atom?​
    5·1 answer
  • Dimples are dominant; no dimples are recessive. Mr. Dowling is heterozygous for dimples, and Mrs. Dowling is also heterozygous f
    9·1 answer
  • 6. In corn plants, normal height (H) is dominant over short height (h). Complete a
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!