1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Maksim231197 [3]
4 years ago
7

A soccer player has been sprinting up and down the field. She is breathing very hard and has a burning sensation in her muscles.

Which of the following is the most likely cause of her symptoms?
A. Muscles are getting rid of carbon dioxide by the Krebs cycle.
B. Muscles are building up lactate from anaerobic respiration.
C. Electron transport chains in the mitochondria are producing too much ATP.
D. Glycolysis is producing too much pyruvate from the high glucose levels in the body.
Biology
2 answers:
svlad2 [7]4 years ago
4 0

Answer:

B. Muscles are building up lactate from anaerobic respiration.

Explanation:

During excessive physical activities such as sprinting,  muscles carry out anaerobic respiration to compensate the need of ATP for their continuous contraction. It is done since oxygen availability can not meet the increased demand of ATP during excess physical activities. Anaerobic respiration in muscles converts pyruvate into lactate which in turn causes burning sensation in muscles.  Hence, her symptoms are due to increased oxygen demand and buildup of lactate in muscles.

Elodia [21]4 years ago
3 0

The correct answer to this question is B. Muscles are building up lactate from anaerobic respiration

You might be interested in
Describe the process of natural selection
Keith_Richards [23]
Natural selection is the process in which the more favorable traits due to mutation that are in a select few in a population produce more offspring then others. An example of this is bacteria resistant to antibiotics due to the faster reproduction of the resistant bacteria over the non resistant ones
3 0
3 years ago
Read 2 more answers
A hypothesis is checked by
k0ka [10]

Answer:

by measuring and examining a random sample of the population being analyzed.

Explanation:

5 0
3 years ago
Read 2 more answers
The main function of this macromolecule is to: jobs in your cells such as building and breaking down molecules.
enot [183]

Answer:

i dont think im smart enough for this question

Explanation:

5 0
3 years ago
CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
miss Akunina [59]
A because like what even is this??
4 0
3 years ago
Harry notices that one of his houseplants does not grow very well compared to his other houseplants. He asks himself “What is di
Ugo [173]
The correct answer is C. "when Henry ask "what is different with this plant that does not grow very well compared with the other house plants?" "
5 0
3 years ago
Other questions:
  • Which repeating units make up proteins
    13·2 answers
  • I need help, please & thank you
    9·1 answer
  • Who criticized Marx for focusing exclusively on economics and social class as explanations for human behavior and advocated soci
    6·1 answer
  • I PUT THIS AS 20 POINTS SO PLEASE HELP! :(
    9·1 answer
  • Judging from the information in the table, which of these stars is least likely to be categorized as a supergiant?
    12·2 answers
  • Which of the following proteins attach desmosomes to one another?
    11·1 answer
  • The amino
    7·1 answer
  • Do living cells ever run out of energy ? Explain.
    13·1 answer
  • Where would you expect to find crystals that formed from a solution ?
    9·1 answer
  • Please help, I have no clue
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!