1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
8090 [49]
3 years ago
8

Sickle-cell trait is apparently an adaptation for the prevention of __________.

Biology
1 answer:
ikadub [295]3 years ago
4 0
Sickle cell trait is apparently an adaptation for the prevention of Malaria.  Sickle cell trait is a condition in which the red blood cells are abnormally shaped, if they inherit two faulty copies of the gene for the oxygen-carrying protein hemoglobin. The faulty gene persists because even carrying one copy of it confers some resistance to malaria. As a result, the frequencies of sickle cell carriers are high in malaria endemic areas. 
You might be interested in
K. Which stage does the following occur
dangina [55]

The stages of the cell division at which each process occur would be as follows:

  • Chromatin condenses into chromosomes - prophase
  • chromosomes align in the center of the cell - metaphase
  • The longest part of the cell cycle - interphase
  • the nuclear envelope breaks - prophase
  • the cell is cleaved into two new daughter cells - cytokinesis
  • daughter chromosomes arrive at the poles - telophase

The cell cycle is characterized by two major events:

  1. The interphase
  2. The m phase

The cell prepares itself at the interphase by growing and increasing in volume, synthesizing DNA and proteins. Thus, the interphase takes a large chunk of the entire cycle.

The m phase represents mitosis. It is characterized by the following phases:

  • Prophase: nuclear envelope dissolves, chromatin condenses to become chromosomes
  • metaphase: chromosomes align at the center of the cell. Each chromosome gets engaged by spindles
  • anaphase: chromosomes are pulled apart by spindles. Sister chromatids start moving to opposite poles
  • telophase: migration to the pole is completed by chromatids

Once the chromatids reach poles, they decondense and a nuclear envelope emerges to surround them. The cytoplasm then divides to give rise to 2 daughter cells in a process known as cytokinesis.

More on the cell cycle can be found here: brainly.com/question/22492624

5 0
2 years ago
How are organisms classified into their different domains and kingdoms?
snow_tiger [21]
Its according to their organs.. where the my come from.. where they inhabit..what the eat.. how they look like..
take for example: reptiles.. they are classified as reptiles cause.. they are the only types of animals who have hard scaled skin not like fish..
5 0
3 years ago
Read 2 more answers
Where are nonpolar amino acids of a protein more likely to be found? check all that apply?
Reptile [31]
They are buried in the core of the structure.
7 0
3 years ago
With regard to gender and the brain research has shown that
Aleksandr [31]

Answer:

variations between the sexes are smaller than variations within each sex

Explanation:

3 0
3 years ago
How does photosynthesis relate to the formation of dna?
Harlamova29_29 [7]

Answer:

During photosynthesis, plants take in carbon dioxide (CO2) and water (H2O) from the air and soil. Within the plant cell, the water is oxidized, meaning it loses electrons, while the carbon dioxide is reduced, meaning it gains electrons. This transforms the water into oxygen and the carbon dioxide into glucose.

Explanation: hope this helps

3 0
3 years ago
Read 2 more answers
Other questions:
  • Describe the difference between and observation and an inference
    13·2 answers
  • Which of these is a method of obtaining petroleum?
    13·1 answer
  • Name one disease of the respiratory system and explain what happens
    15·1 answer
  • THE sun’s layered atmosphere inside to outside: Corona then Chomosphere then photosphere true or false
    12·1 answer
  • Do different color leaves use white light differently for photosynthesis?
    13·2 answers
  • Which of these situation would tend to cause absorption of the largest amount of solar energy
    7·1 answer
  • Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT
    5·1 answer
  • Please Help!! Is this c or d?
    14·1 answer
  • Define the term gene mutation​
    8·2 answers
  • Explain the difference between intra-species and inter-species competition.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!