Explanation:
yes ,it is larger than human sperm..
Is there anyway you can elaborate a little more so I can answer it more clearly? Thanks!!
Answer:
correct option is E) horizontal gene transfer
Explanation:
solution
we know here that phenomenon account for movement of these genes is horizontal gene transfer because we know Horizontal gene transfer are primary mechanism for spreading of antibiotic resistance in the bacteria
and
in many mechanism some are
(1) transformation
(2) transduction
(3) Gene transfer agents
and that Gene transfer agent is virus and it like element encode by host that is occur in alpha proteobacteria
and
we know that implant of one to other plant can transfer chloroplasts , mitochondrial and entire cell nucleus contain the genome to the potential makes new species
as that we can say here correct option is E) horizontal gene transfer
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Answer:
B. Glacier
Explanation:
Sea breezes, land breezes, mountain breezes, and valley breezes are all types of local winds. Glacier are NOT related
---------------------------------------------------------
<u><em>Hope this help :)</em></u>